We narrowed to 10 results for: cycs
-
TypeGuide...Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer... primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...
-
Adeno-associated virus (AAV) Guide
TypeGuide...replicate in the host cell and complete the lytic cycle. AAVs are therefore non-pathogenic and generally... viruses, wild-type AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating...actively causing symptoms or replicating. Lytic cycle Viral replication process where the virus uses the... -
Gamma-Retroviral Vector Guide
TypeGuide...genomes into hosts in order to continue their lifecycle and replicate. This feature can be harnessed for...Gamma-retroviral Packaging Systems The Retroviral Lifecycle Types of Viruses Viral Vector Elements More Viral... -
Lentiviral Vector Guide
TypeGuide...genomes into hosts in order to continue their lifecycle and replicate. This feature can be harnessed for...Lentiviral Plasmid FAQs Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral ... -
CRISPR Guide
TypeGuide...efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during the S and G2 ... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries ... -
Promoters
TypeGuide...from phospholycerate kinase gene TRE Inducible Tetracycline response element promoter U6 Constitutive Human... -
Chemogenetics Guide
TypeGuide...inhibit neuronal signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently... -
Optogenetics Guide
TypeGuide...nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation... -
Molecular Biology Reference
TypeGuide.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be... -
Antibody Guide
TypeGuide...least 10 µL. Antibodies cannot tolerate freeze-thaw cycles. Here are a few tips for storing your antibody:...