Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 34 results for: cycs

Showing: 1 - 20 of 34 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...applications. Use of Tetracycline or a Derivative Doxycycline, a derivative of tetracycline, is a preferred... Plasmid Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression...Stem Cell Research Plasmids Collection Tetracycline Off Tetracycline On Experimental Considerations Tet Plasmids...one of its analogs like doxycycline (dox) is present, TetR binds to tetracycline and releases tet O, enabling...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled...presence of tetracycline, tTA unbinds from the TRE, resulting in reduced gene expression. Tetracycline Off is...binds the TRE in the presence of tetracycline. A new reverse tetracycline-controlled transactivator (rtTA...

  2. p53 Pathway

    Type
    Collection
    ... peptidase Cyclin B CCNB1 CCNB2 CCNB3 Cyclin B1, 2, or 3 Cyclin D CCND1 CCND2 CCND3 Cyclin D1, 2, or 3... 3 Cyclin E CCNE1 CCNE2 Cyclin E1 or E2 Cyclin G CCNG1 CCNG2 Cyclin G1 or G2 CDC25 Cell division cycle...also known as PMAIP1 p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor ...best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in damaged cells...cycle 25C Cdk4/6 CDK4 CDK6 Cyclin-dependent kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase...

  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...:7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic AMP (cAMPr) for mammalian or insect...sensor for cyclic AMP. Sci Signal. 2018 Mar 6;11(520). pii: 11/520/eaah3738. Justin Blau cAMP (cyclic AMP) ...:4003-4012.e6. Xavier Nicol cyclic di-GMP FRET-based biosensor for cyclic-di-GMP measurement Asymmetrical...ratio. Nat Commun. 2013;4:2550. Gary Yellen cAMP (cyclic AMP) Yellow fluorescent cAMP indicator (Flamindo2...2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based cAMP indicator... 2022 Nov;19(11):1461-1471. Haining Zhong cAMP (cyclic AMP) RAB-ICUE red biosensor for monitoring cAMP...pii: 10.1038/s41556-018-0200-6. Jin Zhang cAMP (cyclic AMP) Yellow-emitting homoFRET/anisotropy ICUE cAMP...

  4. Validated gRNA Sequences

    Type
    Collection
    ... Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949 Lu CYC1m promoter... Lu CYC1m promoter S. cerevisiae TGCAAAGGTCCTAATGTATA 64384 activate S. pyogenes 23977949 Lu CYC1m promoter...TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TTACTGTATGTACATACAGT 64378...

  5. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...necessary. Run samples in a thermocycler using the following parameters: Cycles 1-20 (37 °C for 5 min, 20...20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling conditions allow for digestion and ligation...Run samples in a thermocycler using the following parameters: 95 °C for 15 min, 35 cycles of (95 °C for ...approach, the use of T4 PNK is omitted. Anneal in a thermocycler using the following parameters: 37 °C for 30... of intended genomic deletion. Run sample in thermocycler and run the following program: 65 °C for 6 min... Extract the gDNA from clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract...

  6. Bacterial Expression Systems

    Type
    Collection
    ...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518 pDest...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster 36267...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an...

  7. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170...pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes...-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes...GFP-rab11 WT Recycling endosomes Rab11a GFP Richard Pagano 12679 DsRed-rab11 WT Recycling endosomes Rab11a...41163 pEGFP PICH Centromeres (dependent on cell cycle) PICH EGFP Erich Nigg 158008 pCMV-mGold-Tubulin-...

  8. Plasmids for Stem Cell Research

    Type
    Collection
    ...;318(5858):1917-20. Thomson Lentivirus Human Doxycycline-inducible expression of human Oct4, Sox2, Klf4...Cibelli Lentivirus Human Single polycistronic, doxycycline-inducible lentiviral vector for the expression...322(5903):945-9. Hochedlinger Lentivirus Mouse Doxycycline-inducible expression of mouse Oct4, Sox2, Klf4...-9. Jaenisch Lentivirus Mouse Polycistronic, doxycycline-inducible lentiviral vectors for the expression... 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible lentiviral expression of mouse Oct4...Aug 25. 126(4):663-76. Yamanaka piggyBac Mouse Doxycycline-inducible piggyBac transposon reprogramming system... 2011 Mar;21(3):518-29. Cheng piggyBac Mouse Doxycycline-inducible piggyBac transposon reprogramming system...

  9. AAV Molecular Tools

    Type
    Collection
    ...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators... Tools These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression...

  10. Immunology Research Plasmids and Resources

    Type
    Collection
    ...SCM-1, SCM-1a, SCM1, SCYC1 XCL2 chemokine (C motif) ligand 2 SCM-1b, SCM1B, SCYC2 XCR1 chemokine (C motif...CDC42 cell division cycle 42 (GTP binding protein, 25kDa) CDC42Hs, G25K CDK4 cyclin-dependent kinase 4 ... formation of a high avidity BCR through repeat cycles of expansion. Chemokines Chemokines, or chemotactic... formation of a high avidity BCR through repeat cycles of expansion. Symbol Name Synonyms AKT1 v-akt murine...HHT, HHT2, ORW2, SKR3, TSR-I ADCYAP1R1 adenylate cyclase activating polypeptide 1 (pituitary) receptor type...BN, GRP-10, preproGRP, proGRP GUCA2A guanylate cyclase activator 2A (guanylin) GUANYLIN, GUCA2, STARA ...

  11. Ras Pathway

    Type
    Collection
    ...exchange factor 2 CCND CCND1 CCND2 CCND3 Cyclin D CDK CDK4 CDK6 Cyclin-dependent kinase CNKSR CNKSR1 CNKSR2...

  12. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Periaqueductal Gray Facilitate the Itch-Scratching Cycle via Article Tac1-Expressing Neurons in the Periaqueductal...Periaqueductal Gray Facilitate the Itch-Scratching Cycle via Descending Regulation. Neuron 101(1):45-59. ...

  13. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries ...

  15. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of CRISPR systems with wiki entries describing...

  18. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ... wide variety of Cas enzymes? CasPEDIA is an encyclopedia of CRISPR systems with wiki entries describing...

  19. AAV Viral Preps

    Type
    Collection
    ...Spagehetti Monster, Brainbow Molecular Tools Tetracycline Transactivators, Affinity Purification, Cell...
Showing: 1 - 20 of 34 results