Skip to main content

We narrowed to 87 results for: tet on vector

Showing: 61 - 80 of 87 results
  1. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ... a) Cells are transfected with three different vectors and flow cytometry is used to sort populations ...the expression of fluorescent proteins and oxytetracycline enzymes. Next, this system was used to recreate...
  2. Sequencing Primers

    Type
    Guide
    ... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' ...
  3. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...tracrRNA was combined with the sgRNA expression vector allowing the screen to be conducted with only two...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent...
  4. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ...to drive cell type-specific delivery of a viral vector (Strebinger et al., 2023). All this flexibility...a look at some popular self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from...Commercial ligands available Ease of use Tetracysteine (Cys4) 15 Biarsenical dyes (FlAsH, ReAsH...labeling specificity than short peptide tags like tetracysteine (Jing & Cornish, 2011). HaloTag and SNAP-tag...functional. In some cases, a small peptide tag like tetracysteine might be the only option that doesn’t disrupt...options for CLIP-tag and very few TMP-tag or tetracysteine labeling dyes.  If reaction speed is a priority...
  5. Special Delivery: Fluorophore Targeting for FRET Studies

    Type
    Blog Post
    ...intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your protein... nonfluorescent until they bind a 6-residue tetracysteine tag (sequence: CCPGCC) that can be inserted ...interest, resulting in a C-terminal fusion of a tetracysteine tag. In addition, since these tags are so small...et al. "Hairpin structure of a biarsenical− tetracysteine motif determined by NMR spectroscopy." Journal...
  6. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ... JA, Carnes AE, Hodgson CP. Plasmid DNA vaccine vector design: impact on efficacy, safety and upstream...multimeric forms (e.g. concatemers, dimers, trimers, tetramers). Since then, multimerization has been observed...
  7. Promoters

    Type
    Guide
    ...as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The Promoter... Promoters are a vital component of expression vectors because they control the binding of the RNA polymerase...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...
  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag...ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a bicistronic vector rather than a...or search our complete collection and filter by vector type, popularity, and more. Blue/UV Protein Excitation... a fusion protein vector) ZsGreen1-N1 - Mammalian Expression mWasabi 493 509 56 6.5 Monomer mWasabi-N1...93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Return to top Yellow Protein...
  9. Zhang Lab CRISPR Page

    Type
    Collection
    ... in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9...lentiviral vector encoding dCAS9-VP64 with 2A Blast resistance marker 61426 : lentiviral vector encoding...Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, ...61408 : Targeting vector for the mouse Rosa26 locus; Used to make Cas9 knockin mouse Vectors for cancer modeling...SpCas9 or SpCas9n, and the single guide RNA. The vector can be digested using BbsI, and a pair of annealed...indicated below) can be cloned scarlessly into the vector before the sgRNA scaffold. The oligos are designed...gene activation using SAM There are two sets of 3 vectors each available for mammalian endogenous gene activation...
  10. TALEN Plasmids and Kits

    Type
    Collection
    ...contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based ...UTRs are included in the vector to enhance expression of the message. Both vectors utilize homodimeric FokI...Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis vectors containing...RCIsricpt-GoldyTALEN are designed as destination vectors for the Voytas lab Golden Gate TALEN kit. The GoldyTALEN...mutation at rates much higher than the parental vectors. pC-GoldyTALEN directs expression of TALENs from...pTAL6-BB are designed as alternative destination vectors for the Golden Gate TALEN kit (Bogdanove/Voytas...the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression. pTAL6-BB ...
  11. AAV Viral Preps

    Type
    Collection
    ... Viral Vector Packaging...Browse In-Stock AAV Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively... in small volumes, and ready to ship. All viral vector preps are purified by density centrifugation. Addgene...or AAVrg). For more information, visit our Viral Vector Packaging Service overview. Function Chemogenetics...Serotype Testing Samples Small samples of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 6, ...viral vectory packaging service. Browse constructs currently available in viral format. Viral...Spagehetti Monster, Brainbow Molecular Tools Tetracycline Transactivators, Affinity Purification, Cell...
  12. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Activity with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and FLEx Vector Expression Plasmids 101: Knockout...you can do with it, read Addgene's blog on FLEx Vectors . Flp-IN: A single FRT site within the genome of...to minimize leakiness in experiments using AAV vectors. Highlighted Plasmids Browse the tables below to...Cre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore...and filter the results by expression system and vector type. Find in-stock viral preps expressing Cre ...Flp Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search...and filter the results by expression system and vector type. Find in-stock viral preps expressing Flp ...
  13. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...plasmids, visit Addgene's Empty gRNA Expression Vectors page and search the table for "Bacteria". Activate...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic...
  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off Full...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...HiBiT-TREM2 Vector TREM2 HiBiT CMV Alzheimer's Promega Corporation 238681 NanoLuc-TREM2 Vector TREM2 NanoLuc...HaloTag-TREM2 Vector TREM2 HaloTag CMV Alzheimer's Promega Corporation 238706 NanoBRET Assay Vector, CSF1R-NanoLuc...PINK1-SmBiT Vector PINK1 SmBiT CMV Parkinson's Promega Corporation 238783 PINK1-LgBiT Vector PINK1 LgBiT...LgBiT-TREM2 Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238801 TREM2-SmBiT Vector TREM2 SmBiT...LgBiT Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238850 EIF2AK2-NanoLuc Fusion Vector EIF2AK2...
  15. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells...mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging PI Return to ...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca 2+ dynamics in mammalian...Yulong Li ADP Biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...
  16. CRISPR Guide

    Type
    Collection
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...based genome engineering from a single lentiviral vector. Nucleic Acids Research , 42 (19), e147. PMID: ...
Showing: 61 - 80 of 87 results