We narrowed to 958 results for: Tes

1. Management for Scientists: Managing vs. Leading

   Type

   Blog Post

   ...successful leaders. Below I've listed a few of my favorites. Additionally, you can find more suggested resources...

2. Management for Scientists: Giving Feedback

   Type

   Blog Post

   ...feedback session by writing down specific examples and notes so you can get back to the issues if the conversation...

3. Management for Scientists: What Makes a Good Manager Anyway?

   Type

   Blog Post

   ...prefer to be approached as peers rather than subordinates Need mental space and dislike intrusions (this...

4. Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life

   Type

   Blog Post

   ...collectively as Greening the Classroom, were developed and tested by ABRC staff. These kits provide in-depth, ready-to-teach...

5. RUBY-Red Siliques

   Type

   Blog Post

   ... produces 3 enzymes from a single mRNA using 2a sites. These convert the amino acid tyrosine to betanin...

6. Antibodies 101: Epitope Availability

   Type

   Blog Post

   ... your controls in validation, as you may need to test different configurations and conditions to understand...

7. Antibodies 101: Avoiding the Mouse on Mouse Mess in IHC

   Type

   Blog Post

   ...against the sample species to block the binding sites on endogenous IgGs before you add your primary and...

8. Antibodies 101: Epitope Tags

   Type

   Blog Post

   ...tag has been used with moderate to high success rates across all applications. You can find FLAG antibodies...

9. What the HEK?

   Type

   Blog Post

   ... skew research results (gene expression, growth rates, etc.). Thus, it’s important to maintain short culture...

10. The Strength of Story Telling

    Type

    Blog Post

    ...around the self, too — when talking to friends or dates or colleagues we tell tales about parts of our lives...

11. Celebrate Open Data Day with Addgene’s AAV Data Hub!

    Type

    Blog Post

    ...general question types and it takes approximately 15 minutes or less if you have all of your data prepared. ...

12. Mentoring for Scientists: I Have a Mentor, What Now?

    Type

    Blog Post

    ... Make agendas for your meetings, take informal minutes on what was covered and learned, especially noting...

13. Extracurricular Activities for a Strong Science Career Path

    Type

    Blog Post

    ...the potential job Join LinkedIn and other job sites to find open positions and view their required qualifications...

14. Sequencing Primers

    Type

    Guide

    ...primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...

15. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type

    Blog Post

    ...professionals can genotype the patient and rapidly test the variants in vitro against different drugs and...

16. Improving Transduction Efficiency with Exosome AAVs

    Type

    Blog Post

    ...Sarah J., et al. "Exosome-associated AAV2 vector mediates robust gene delivery into the murine retina upon...

17. Reagent Repositories Are Speeding up Science During the Pandemic

    Type

    Blog Post

    ... Bioresources Cell Bank, part of the National Institutes of Biomedical Innovation, Health, and Nutrition...

18. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type

    Blog Post

    ...genes are flanked by EcoRI and BamHI restriction sites - so cloning projects should be fun and straight-forward...

19. 25 Work From Home Tips for Scientists

    Type

    Blog Post

    ...for bench scientists to assist in labs that are testing for COVID-19. You can also give back by supporting...

20. Learning Technical Skills at a Lab Central Workshop

    Type

    Blog Post

    ... easy to use because it required only about 15 minutes of my hands on time and a total of about 3 hours...