Skip to main content

We narrowed to 16 results for: Tes

Showing: 1 - 16 of 16 results
  1. Molecular Cloning Techniques

    Type
    Guide
    ... has restriction sites on either side of it into any plasmid that has the same sites in the same orientation...systems is that like restriction enzyme sites, type IIS sites can be found throughout endogenous DNA sequences...double-stranded DNA (dsDNA) at specific sequence sites in the DNA. In restriction cloning, scientists utilize...expression contain several popular restriction enzyme sites, usually within the multiple cloning site (MCS)....short length, it is also easy to add restriction sites to any piece of DNA during PCR amplification, allowing...important to note that restriction enzyme target sites can be repeated throughout a specific DNA sequence...already be surrounded by specific recombination sites — similar to restriction enzyme cloning. To do this...
  2. Molecular Biology Reference

    Type
    Guide
    ...fragments of DNA, or templates, are spatially separated. These attached DNA templates are then amplified...Alternative start codons include CUG in eukaryotes and GUG in prokaryotes. Common Epitope Tags Tag Amino Acid...DNA. Although they can be found in archaea and eukaryotes, they play the most significant biological role...fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used ...relatively quickly, and exhibit exponential growth rates, plasmids can be replicated easily and efficiently...of DNA which contains several restriction enzyme sites, enabling easy insertion of DNA by restriction enzyme...and ligation. As a general rule, the restriction sites in the MCS are unique and not located elsewhere ...
  3. CRISPR Guide

    Type
    Guide
    ...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for... used for small precision edits. NHEJ directly ligates the break ends without the need for a homologous...large genomic deletions or inversions with two gRNA sites on the same chromosome. Most multiplex systems enable...most gRNA targeting sequences will have additional sites of partial homology throughout the genome, called...Modifications Using Homology Directed Repair (HDR) HDR generates specific genomic edits by copying from a DNA donor...mutation, while whole plasmid or linear dsDNA templates work better for large edits or insertions. When..., where Cas9n nicks the non-target strand and generates a 3’ flap. However, the longer pegRNA also encodes...
  4. Antibody Guide

    Type
    Guide
    ...response has developed, the antibodies are collected, tested against the antigen, packaged, and sold. This is...immortalized B cells). The genetic reorganization that creates variety in the antibody allowing for their extreme...class therefore has a valency, or number of binding sites available per antibody unit, which is typically ...multiplied by two, as each antibody has two binding sites. Isotype Description Configuration and Valency Subclasses...Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic reactions...in the lab. Check for and record any expiration dates. Buffers Buffers are a concern for conjugating and...reaction in the presence of several different substrates. The luminescence produced by the reaction can...
  5. Plan Your Experiment

    Type
    Guide
    ...additional sites throughout the genome. These sites are called off-targets. Be aware of off-target sites when...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific...that there could be downstream translation start sites that could allow for expression of a truncated protein...PAM sequences or Cas9 enzymes with flexible PAM sites . Base Editing : Target the site of your desired...complement to your target sequence with no homologous sites elsewhere in the genome. In reality, a given gRNA...genetic cargo (in this case, CRISPR components) integrates into the genome. Lentiviral vectors are a good...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...incompetent by using four plasmids instead of three and eliminates the requirement for Tat. Always includes deletion... transfer plasmids may have limited restriction sites or may only be compatible with certain cloning methods...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...more accurately predict and understand integration sites have led to the development of multiple genome-wide...al. (2020) for examples). Pseudotyping Tropism dictates which types of host cells the lentiviral vector...glycoprotein — transduce airway epithelium and cardiomyocytes in utero Rabies glycoprotein — transduce neural...for genome-wide mapping of lentiviral integration sites. Molecular Therapy — Methods & Clinical Development...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...available inside of the small AAV capsid and directly correlates to the size of the DNA removed from the viral... transfer plasmids may have limited restriction sites or may only be compatible with certain cloning methods...is crucial for efficient AAV replication as it activates the necessary cellular machinery to produce large...Random integration of rAAV genomes in non-homologous sites of the host genome can occur, although at a low ...a slash (e.g. AAV2/5), where the first number indicates the serotype of the genome and the second number...specific cell types of interest has been to create and test capsid libraries with random mutations or insertions... PNS (e.g. AAV-PHP.S) in rodents and non-human primates. Read our blog post on systemic capsids for more...
  8. Adenovirus Guide

    Type
    Guide
    ... inside of the adenoviral capsid and directly correlates to the size of the DNA removed from the viral... transfer plasmids may have limited restriction sites or may only be compatible with certain cloning methods...with rAdV vectors, or to verify that the infection rates are equivalent across multiple viruses. The adenoviral... preferentially infect certain tissues, which correlates with the specific diseases they cause. Ad5 and...a slash (e.g. Ad5/35), where the first number indicates the serotype of the genome and the second number...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...) vectors have also been developed as vaccine candidates for multiple infectious diseases and prostate...
  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...transcription start sites, such as promoters and enhancers. Many times, integration sites are found in proto-oncogenes... transfer plasmids may have limited restriction sites or may only be compatible with certain cloning methods... packaging cell line. This system provides the greatest flexibility to pseudotype gamma-retrovirus using...possible development of cancer. Pseudotyping Tropism dictates which types of host cells the gamma-retroviral... virus with the envelope glycoproteins of HIV generates a retroviral vector with specificity of infection...transcription. Removal of this region in the 3’ LTR creates self-inactivating viral vectors. R in cis Repeat...constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started by 5' LTR by the addition...
  10. Chemogenetics Guide

    Type
    Guide
    ...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or ...activated through chemogenetic or optogenetic routes. Image courtesy of Ute Hochgeschwender . Table 3: Descriptions...that bind a specific ligand. Ligand binding then activates G-proteins to modulate downstream signaling. GPCRs...back-metabolized to clozapine and other clozapine metabolites and these can have off-target effects. More recent...allows for influx of Na + and/or K + ions, and activates neuronal activity. Figure 3: PSAM4-based ligand-gated...Krashes, M. J., … Roth, B. L. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...
  11. Promoters

    Type
    Guide
    ...the other hand, the process in eukaryotes is much more complex. Eukaryotes require a minimum of seven transcription...are common in prokayotes, specifically bacteria, but have also been discovered in eukaryotes. Operons consist...binding is very different in bacteria compared to eukaryotes. In bacteria, the core RNA polymerase requires...Transcription is tightly controlled in both bacteria and eukaryotes by various DNA regulatory sequences, including...promoter also contains transcription factor binding sites, but mostly contains regulatory elements. Common...
  12. Optogenetics Guide

    Type
    Guide
    ...substrate is added, the luciferase enzyme generates light that activates the opsin. While LMOs can also be activated...as adrenergic receptor, makes a receptor that activates the native signaling cascade upon light exposure...synthetic kinase incorporating a LOV domain) phosphorylates the transcriptional activator FixJ, driving...range from milliseconds with hChR2 to seconds or minutes with stable step-function opsins (SSFOs). Delivery...
  13. Modular Cloning Guide

    Type
    Guide
    ...sequences, terminators, etc.) flanked by fusion sites into individual Level 0 plasmids, or choose from...create plant expression vectors containing several cassettes and generate multi-construct transgenic plants...protein complexes in various hosts. Expression cassettes for individual subunits are first assembled by...
  14. Science Guides

    Type
    Guide
    ...experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure and...
  15. Sequencing Primers

    Type
    Guide
    ...Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC...
  16. Guide to Using Pooled Libraries

    Type
    Guide
    ... target genes or regulatory regions, where it stimulates transcription by recruiting activators or modifying...
Showing: 1 - 16 of 16 results