We narrowed to 965 results for: tes

...transcriptional activation from the 5’ LTR) and Rev (facilitates nuclear export of transcripts). A different viral...

...the world is unprepared. Each year in the United States, two million people will be infected by antibiotic...

...early research career. I've found that research institutes in different places have very different cultures...

...envelope plasmid you use as the choice of envelope dictates the tropism of the virus.  VSV-G is very common...

...protein tools that are activated, respectively, by substrates, light, or engineered ligands (Figure 2). Biosensors...

...amplification. Transformed E. coli are allowed to grow on plates or in liquid culture to amplify the library, followed...

...machinery (Novick, 1987). In cases where one plasmid outcompetes the other, usually a smaller, higher copy plasmid...

...was most productive in short bursts (even twenty minutes was enough to make some progress). For most researchers...

...too many to describe here, but I have over 2,000 notes which Evernote even allows me to access on my phone...

...you want to activate, you should also be ready to test three or four guides directed towards that gene ...

...vesicular stomatitis virus G protein (VSV-G), which facilitates viral entry into the host cell.  Transfecting...

...doi.org/10.1038/s41565-019-0375-4 Lowder LG, Zhang D, Baltes NJ, Paul JW III, Tang X, Zheng X, Voytas DF, Hsieh...

...transduce neurons for retrograde labeling, as well as astrocytes in the CNS (Han et al., 2023), and has also been...

... the strong yeast promoter pTEF). As ethanol accumulates, it binds to the repressor, enabling it to bind...

... clustering and discovery algorithms find new candidates for CRISPR proteins. A type VII is already on...

...experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure and...

...descriptions first before entering the data. This step associates an Addgene ID with your plasmids, and adding ...

...Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC...

... target genes or regulatory regions, where it stimulates transcription by recruiting activators or modifying...

...also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process...