We narrowed to 955 results for: tes
-
TypeBlog Post...vesicular stomatitis virus G protein (VSV-G), which facilitates viral entry into the host cell. Transfecting...
-
CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9
TypeBlog Post...doi.org/10.1038/s41565-019-0375-4 Lowder LG, Zhang D, Baltes NJ, Paul JW III, Tang X, Zheng X, Voytas DF, Hsieh... -
Plasmids 101: Repressible Promoters
TypeBlog Post... the strong yeast promoter pTEF). As ethanol accumulates, it binds to the repressor, enabling it to bind... -
Viral Vectors 101: AAV Serotypes and Tissue Tropism
TypeBlog Post...transduce neurons for retrograde labeling, as well as astrocytes in the CNS (Han et al., 2023), and has also been... -
Typing CRISPR Systems
TypeBlog Post... clustering and discovery algorithms find new candidates for CRISPR proteins. A type VII is already on... -
Science Guides
TypeGuide...experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure and... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...descriptions first before entering the data. This step associates an Addgene ID with your plasmids, and adding ... -
Guide to Using Pooled Libraries
TypeGuide...maxiprep). If delivering as virus, make virus; this creates a pooled lentiviral CRISPR library. Apply pooled... -
Sequencing Primers
TypeGuide...Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC... -
Protocol - How to Design Primers
TypeProtocol...also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process... -
Protocol - How to Create a Bacterial Glycerol Stock
TypeProtocol...2 mL screw top tube or cryovial and gently mix. Notes: Make the 50% glycerol solution by diluting 100%... -
Protocol - How to Streak a Plate
TypeProtocol... Agar Plate You may also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA... -
Fluorescence Titering Assay
TypeProtocol...lots of FBS can promote or inhibit transfection. Test a variety of brands and lots of FBS to find one ... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol... in a final concentration of 10% bleach for 30 minutes before pouring down the drain. Solid BSL-2 waste... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...PES filter or centrifugation at >500 x g for 5 minutes. Do not use the medium if the cells are overly ...