Skip to main content

We narrowed to 844 results for: Tat

Showing: 121 - 150 of 844 results
  1. Microbiology Resources

    Type
    Collection
    ...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ...
  2. Worm Expression Resources

    Type
    Collection
    ...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed...
  3. Promega Plasmid Collection

    Type
    Collection
    ...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT...
  4. AAV Molecular Tools

    Type
    Collection
    ... microtubule-associated protein tau with P301L mutation. 1 Tsuneya Ikezu 203840 pAAV-hSyn-Kir2.1WT-2A-...
  5. Open Enzyme Collection

    Type
    Collection
    ...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ...
  6. CRISPR Plasmids - Tagging

    Type
    Collection
    ...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ...
  7. Optogenetics AAV Preps

    Type
    Collection
    ...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...
  8. Sequencing Primers

    Type
    Guide
    ...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. ...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end ...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...
  9. 3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells

    Type
    Blog Post
    ...blocking mutation. Despite the fact that both the blocking mutation and our intended mutation were on ...or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking mutations After genome editing...sequence. The idea was that these “blocking mutationsmutations prevent CRISPR from re-cutting the target...blocking mutations? This depends entirely on the locus you are editing, and if the blocking mutation needs...intended mutation while taking advantage of the improved efficiency provided by blocking mutations. Essentially...cut site to mutation distance and editing efficiency.   3. Optimizing "cut-to-mutation distance" for... Alzheimer mutations we study are heterozygous in patients. As the probability of mutation incorporation...
  10. CRISPR Guide

    Type
    Guide
    ...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...
  11. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...applies to plasmids, but may also facilitate genome editing. Tailored mutations are commonly introduced to endogeneous...brief, point-mutations can be introduced to plasmids using primers (with the desired mutation) in a PCR ...mutagenesis vastly facilitates the subsequent process of screening for succesfully mutated clones. Forward...introduction of specifically designed mutations (not limited to frame shift mutations). Consequently, site directed...restriction sites), in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in...high homology to the endogenous target, yet to facilitate the repair, the template should be resistant ...template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG sequence critical for ...
  12. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP ...chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 nm peak and minor 475 nm...
  13. Optogenetics Guide

    Type
    Guide
    ...improve these natural opsins by inducing point mutations to alter the absorption spectrum or adding trafficking...physiological pH and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains... as light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...
  14. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...within atoms to a higher energy state. This process is called excitation. After a short period, the electrons...lower energy state, whereby a photon is emitted. This step is called emission. During excitation, some of ...speak of excitation and emission spectra. Both spectra possess clear maxima where excitation and emission... to the global maximum of PE's excitation spectrum where the excitation efficiency is much greater. As...signal.   Figure 2: Excitation and emission spectra for PE. The excitation spectrum shows two maxima...While APC's global excitation maximum lies around 650 nm, APC-Cy7's global excitation maximum is about ... Figure 3: Excitation and emission spectra for APC and APC-Cy7. While the excitation spectra of both...
  15. Targeted Mutagenesis with EvolvR

    Type
    Blog Post
    ...culture, so bacteria must be grown in a turbidostat. Only mutate particular types of nucleotides. Both...rate was 2.5 x 10-6 mutations per nucleotide per generation vs. 10 x 10-10 mutations per nucleotide per...increase the mutation rate and extend the editing window of EvolvR: (1) two additional mutations to PolI3M...many known spectinomycin resistance mutations, several new mutations were identified by targeting EvolvR...to generate specific mutations in your plasmids Use REPLACER Mutagenesis to mutate your plasmid Resources... sequence can help scientists identify and/or facilitate the evolution of new phenotypes, and forward ...bacterial growth conditions in order to maximize the mutation rate. For example the Phage Assisted Continuous...
  16. Screening for Successful Genome Editing with Digital PCR

    Type
    Blog Post
    ...Surveyor® or T7E1) for mutation detection. While these methods paved the way for mutation validation, we found...individual target molecules based on their mutation status. The drop-off probe is designed to perfectly...and is not capable of binding a mutated target. The amount of both mutated and wild type target in each ...samples with mono-allelic mutations versus those with the bi-allelic mutations typically desired when screening... comes time to (hopefully) validate successful mutation of your favourite gene, there are several different... to help guide you through the rough waters of mutation validation, such as this "CRISPR 101" post. Next-generation...Since there are many thousands of partitions, statistical modelling can be used to determine the actual...
  17. Choosing the B(right)est Fluorescent Protein: Photostability

    Type
    Blog Post
    ...fluorophore primarily depends on the excitation power and the excitation wavelength. A fluorophore is less...absorb the excitation light less efficiently. Similarly, decreasing the power of the excitation light reduces...acquired at low excitation powers. Note, however, that, at a 14-fold higher excitation power, the photostability...lightbulb or exchanging excitation filters). This avoids substantial changes in excitation power and will help...reduces the number of excitation/emission cycles per unit of time, decreasing the likelihood that a fluorophore...story. The photobleaching rate does not depend on excitation power in a linear fashion. This implies that ...Cranfill et al, 2016). This non-linear dependence on excitation power is important since different fluorescence...
  18. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ... electrons are elevated from a ground state to an excited state through the absorption of photons. After... elevation in this excited state, the electron returns to its ground state by emitting a photon with slightly...10 nm) and overlap of excitation profiles is vital for the accurate interpretation of FRET-based experiments... or the difference in wavelength between peak excitation spectrum and emission spectrum. Fluorescent dyes...chemical structure, leading to differences in their excitation and emission wavelengths, which are pivotal in...dye is fluorescein isothiocyanate (FITC), with excitation and emission peaks at 495 and 517 nm. FITC binds...this include coupling to an antibody, whereby excitation of blue light will indicate where FITC is bound...
  19. Plasmids 101: FLEx Vectors

    Type
    Blog Post
    ... same orientation, the SSR will excise the DNA fragment. By manipulating the number, orientation, and ...the sense orientation, followed by the mCherry coding sequence in the antisense orientation (Figure 1,...Introduction of a conditional point mutation or functional mutation in vivo: Similar to a conditional rescue...-specific recombination events, and that the orientation of the flanking loxP sites directs the Cre recombinase...recombination. The FLEx switch takes advantage of the orientation specificity of the site-specific recombinases...flanked by target sites (floxed) in opposing orientations, a SSR will invert the DNA sequence between ...wild-type pair (loxP, black arrowheads) and one mutated pair (for example- lox511, white arrowheads). It...
  20. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...metal disk containing a number of holes rotates through the excitation light path. Each hole corresponds to...traditional confocal due to limitations in light penetration mentioned above (5). Thick static samples Ex: Fixed...detector or restricting fluorescence to specific excitation volumes to enhance spatial contrast (i.e. optical...microscopy. Collimated (non-converging or diverging) excitation light exits the microscope objective evenly illuminating... CT scanner. This is accomplished by focusing excitation light to a point in the sample and raster scanning...First, widefield and confocal microscopy project excitation light through the entire axial volume of a sample...signal intensity. 2-Photon microscopes restrict excitation (and bleaching) to a single focal point. This...
  21. Exploring Applications of the Bioluminescent HiBiT Tag

    Type
    Blog Post
    ...with an R175H mutation to match a frequent mutation in early-onset GC and one with a mutation at R273H to...neighboring cells with pro-oncogenic traits, facilitating metastatic spread. The authors used NanoBiT assays...blotting, methods that are low-throughput, semi-quantitative, and provide only snapshots rather than continuous...continuous views of protein activity. Together, these limitations create challenges for measurements needed to ...with the native function of tagged proteins and facilitates precise CRISPR-based tagging, or low-levels of..., work across cell models, and even introduce mutations. This vector-based use of HiBiT provides a means...obscure weak signals; photobleaching from the excitation light, causing the signal to gradually diminish...
  22. Plan Your Experiment

    Type
    Guide
    ...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...many different types of edits, including point mutations, base changes, and large insertions or deletions...increases specificity but is less efficient Each putative knockout allele must be experimentally verified...) Generate specific genomic edits, like point mutations or small tag insertions, by copying from a DNA...Generate targeted insertions, deletions, and point mutations using a prime editing guide RNA (pegRNA) Prime... alternative splicing, and an early frameshift mutation is more likely to result in a non-functional protein...as there are for viral vectors — the only size limitation is what you can efficiently transfect. However...
  23. REPLACR Mutagenesis: Replacing In Vitro Recombination Methods

    Type
    Blog Post
    ...Types of Mutations Insertions, deletions, point mutations Insertions, deletions, point mutations Insertions...inactivating/activating mutations. In biomedical research, modeling patient mutations using SDM can help determine... make a point mutation, you design two oligonucleotide primers with the desired mutation, then use those...Insertions, deletions, point mutations Insertions, deletions, point mutations PCR Reactions 1 1 1 per fragment...commercial kits are available for making small point mutations, large deletions/insertions require complicated...PCR amplify the template plasmid. The parental, nonmutated DNA is digested with methylated DNA-specific ...express phage recombination machinery, which facilitates easy genetic modification by homologous recombination...
  24. The Advances Behind The World's First Personalized CRISPR Treatment

    Type
    Blog Post
    ... to indel mutations that plagued CRISPR editing at the time. KJ was born with a C→T mutation on one allele...tested Cas9 mutations that imposed a preference for an NGC PAM. Although all the tested mutations produced...editors to problematic mutations would need to change to target different mutations in different patients...gene editing therapy personalized to his genetic mutation. “Baby KJ” was diagnosed with a rare and dangerous...mean researchers can fix any problematic C or A mutations in the genome. Off-target effects, editing efficiency...and developed a deaminase variant with a V106W mutation, which reduced RNA editing to background levels...cost of reducing editing efficiency. The V106W mutation was an important addition. Improved activity of...
  25. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...uptake, iron uptake receptor mutation. T1/T5 Phage resistance gal Mutation in galactose metabolism pathway...DNA, preparing unmethylated DNA, and more. Many mutations that make these features possible are present ...present in most commercial strains, especially mutations that make major improvements such as those that increase...found in E. coli strains. Table 1: Common gene mutations found in E.coli strains Gene(s) Description...Functional Consequence dam DNA adenine methylase mutation (GATC) Preparing unmethylated DNA, important when...ex: ClaI or XbaI) dcm DNA cytosine methylase mutation (CCWGG) Preparing unmethylated DNA, important ...enzymes that are methylation sensitive. dnaJ Mutation in a chaperonin gene Increases the stability of...
  26. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...wildtype protein and facilitating its widespread use in research. Many other mutations have since been introduced... and their mutations relative to wildtype GFP. Although not listed here, many permutations within each... and the mutation definitions found in Table 2 may not apply. Table 1: The specific mutations comprising...2: Functional role of specific mutations in GFP derivatives Mutation Known Function S65T Increased...little truncation is tolerated, however, point mutations are acceptable. GFP's main advantage over conventional...In 1995, Roger Y. Tsien described an S65T point mutation that increased the fluorescence intensity and ...photostability of GFP. This also shifted its major excitation peak from 395 nm to 488 nm, effectively ameliorating...
  27. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...span the knock-in gene. For making mutations, one good way is to mutate the PAM 'NGG' sequence in the HR...silent mutation. Q9: When attempting to use the CRISPR/Cas9 system to create specific mutations or insertions...possible. For introducing small mutations (<50 bp) or a single-point mutation, the best HR template for transfection...the introduction of a mutation into the genome, how can cells with that mutation be selected/screened?...on each side flanking your desired insertion or mutation. Each arm is around 800 bp. For transfection in...the HR template, you usually would need to make mutations of the HR template to avoid this donor plasmid...being degraded by Cas9 in cells. One good way is to mutate the PAM 'NGG' in the HR template, like change it...
  28. Mouse Modeling, Part 2: Breeding and Crossing Mice

    Type
    Blog Post
    ...commonly used to introduce multiple mutations. This is because as more mutations are introduced into a single...arise when crossing mice with multiple mutations is if the mutations are on the same chromosome. Homologous...engineering should be used to separately introduce each mutation independently into different mice, and then these...production of offspring that have a combination of the mutations engineered into each of their parents. Here’s ...mice that are each homozygous for one of the two mutations that you want combined in your offspring. Genotyping...producing mice with your desired combination of mutations. Assuming your parental mice were all homozygous... to a mouse that is homozygous for a different mutation, the F1 offspring will be either hemizygous or...
Showing: 121 - 150 of 844 results