...below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search for "ChR ...

...enzymes generate double strand breaks (DSBs). Nick Mutated Cas nickase enzymes generate single-strand DNA ...

... chiRNA plasmid can be coinjected to generate mutations via imperfectly repaired DSBs. Coinjection of ...

...with details about storage. Biosafety Guide Documentation for your institutional biosafety office and ...

...modification, or variant. ID Plasmid Description Mutations Industry PI Due to export control regulations,...

...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...

...these approaches have created this resource to facilitate open and free exchange of these expression plasmids...

...leading synthetic biologists around the world to facilitate the sharing of parts and information. Addgene...

...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically...

...modular inserts for seamless assembly of multiple mutations, alterations, or transgene insertions into single...

...Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor...

...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ...

...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed...

...delivery has many advantages for research. Viruses facilitate the delivery of genetic information to hard-to-transfect...

... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...

...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ...

...reference spectra or phosphopeptide standards for quantitative assessments. The mode #1 phosphosite library...

...important for tetracycline-dependent repression. Mutating these residues led to the development of a reverse...

...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ...

...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

...provide AAV viral preps, includes listing of transfer status for viral preps....

...LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, ... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...

...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...

...improve these natural opsins - by inducing point mutations to alter the absorption spectrum or adding trafficking...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains... as light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...

...Furthermore, in cells containing two mutated alleles, each mutated allele may be different owing to the...Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed... type or organism without a specific preferred mutation Cas9 (or Cas9 nickase) Single (or dual) gRNA targeting...increases specificity but is less efficient. Each putative knockout allele must be experimentally verified... a particular gene, such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base...knockout. Base editors can make a limited set of mutations. Repress or Interfere (CRISPRi) Reduce expression... the N-terminus are targeted since frameshift mutations here increase the likelihood that a nonfunctional...

...protein complexes. Includes: Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - ...Capture methods such as immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate...which emit a specific wavelength of light after excitation by light of a specific wavelength. While more...interactions in a specific timeframe or context. Immunoprecipitation (IP) IP uses immobilized antibodies to isolate... on the same general strategy. Figure 5: Immunoprecipitation using bead-based antibody capture to isolate...isolating protein from serums. Chromatin immunoprecipitation (ChIP) This variation of IP uses antibodies...for individual assays. Clear cell debris by sedimentation. Proceed with IP using a primary antibody for...

...template strand can initiate. The TATA box is a DNA sequence (5'-TATAAA-3') within the core promoter region...transcription of a given gene. The TATA-binding protein binds the TATA box and helps in the subsequent binding...Their equivalent to the eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and...codon and contains the RNA polymerase binding site, TATA box, and transcription start site (TSS). RNA polymerase...Only eukaryotes and archaea, however, contain this TATA box. Most prokaryotes contain a sequence thought... which usually consists of the six nucleotides, TATAAT. Proximal Promoter Further upstream from the core...

...blocking mutation. Despite the fact that both the blocking mutation and our intended mutation were on ...or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking mutations After genome editing...sequence. The idea was that these “blocking mutations” mutations prevent CRISPR from re-cutting the target...blocking mutations? This depends entirely on the locus you are editing, and if the blocking mutation needs...intended mutation while taking advantage of the improved efficiency provided by blocking mutations. Essentially...cut site to mutation distance and editing efficiency.   3. Optimizing "cut-to-mutation distance" for... Alzheimer mutations we study are heterozygous in patients. As the probability of mutation incorporation...

...applies to plasmids, but may also facilitate genome editing. Tailored mutations are commonly introduced to endogeneous...brief, point-mutations can be introduced to plasmids using primers (with the desired mutation) in a PCR ...mutagenesis vastly facilitates the subsequent process of screening for succesfully mutated clones. Forward...introduction of specifically designed mutations (not limited to frame shift mutations). Consequently, site directed...restriction sites), in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in...high homology to the endogenous target, yet to facilitate the repair, the template should be resistant ...template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG sequence critical for ...

...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP ...chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 nm peak and minor 475 nm...