We narrowed to 400 results for: AGA
-
TypeBlog Post... Although it’s possible to generate antibodies against many types of molecules including proteins, lipids...hybridomas come from animals that were immunized against the target protein. Animals are first injected ...special medium called HAT. This medium selects against unfused myeloma cells and antibody-producing B ...
-
Opto-Nanobodies: Using Light to Manipulate Cell Signaling and Protein Purification
TypeBlog Post... to generate two more OptoNBs, one against mCherry and one against GFP. Insertion of AsLOV2 into loop ...improve this process. The team used nickel-coated agarose beads coated with his-tagged OptoNBs. OptoNB coated... -
Luminescent Imaging with Nano-lanterns
TypeBlog Post...luminescent imaging a reality, Addgene depositor Takeharu Nagai and colleagues at Osaka University have developed...signal. Since their first publication in 2012, the Nagai laboratory has assembled a collection of multicolored...imaging. Nano-lanterns and your experiments The Nagai laboratory has a done a wonderful job characterizing... -
Uncertainty about Labor Law Brings More Uncertainty to Postdoc Wages
TypeBlog Post... preliminary injunction against the FLSA updates was granted nationwide. Again, we at Future of Research...This post discusses how a nationwide injunction against the FLSA is affecting universities' decisions to... -
Pairing CombiGEM and CRISPR for Combinatorial Genetic Screening
TypeBlog Post...: Forward oligo: 5’- CACCGNNNNNNNNNNNNNNNNNNNGTTTGGGTCTTCGAGAAGACCTATTCXXXXXXXXC -3’; Reverse oligo: 5... 5’- AATTGXXXXXXXXGAATAGGTCTTCTCGAAGACCCAAACNNNNNNNNNNNNNNNNNNNC -3’, where NNN and XXX represent the ... -
A Look at Addgene's QC Process
TypeBlog Post...However, the cloning process — including the propagation of plasmids in bacteria — has many points at ...called Geneious. Here, the raw reads are mapped against a reference sequence, if one was provided. If no...plasmid, and the full QC process is started over again after receiving the replacement plasmid at Addgene... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post...Please indicate which growth strain Addgene should propagate your plasmids in: DH5α, NEB Stable, ccdB Survival...Survival, Pir1, or other. Whenever possible, we propagate plasmids in the standard cloning strain DH5α. For...choose the Pir1 strain. If your plasmid cannot be propagated in any of these standard strains, choose other... -
xCas9: Engineering a CRISPR Variant with PAM Flexibility
TypeBlog Post... transcription of gene III, permitting phage propagation and keeping that dCas9 sequence in the pool. ...with BioRender.com. After 24 days of phage propagation, Hu et al. isolated xCas9 1.0-1.4 and subjected...were capable of cleavage, they tested the clones against an NNN PAM library in bacteria where cleavage leads... -
Transgenic Organisms, Cas9 Gene Drives, and Appropriate Safeguards
TypeBlog Post...spreads through the wild population and immunizes it against the first drive. Laboratories interested in building...question), why not use them whenever applicable?Against this, consider the cost of an accidental release...accidental release could delay real-world applications against scourges such as malaria and dengue for many years... -
pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs
TypeBlog Post...reprogramming efficiency through the expression of a shRNA against p53, a modified reprogramming factor cocktail, ... pCXLE-hOCT3/4-shp53-F 27077 OCT3/4 and shRNA against p53 pCXWB-EBNA1 37624 transient EBNA-1 ...19668191. PubMed Central PMCID: PMC2917235. 11. Nakagawa, M., et al., Promotion of direct reprogramming... -
Viral Vectors 101: Pseudotyping
TypeBlog Post...lines expressing galactosyl(alpha1-3)galactosyl (alphaGal) sugars were less stable than viruses produced...express these sugars. (Takeuchi et al., 1997). The alphaGal sugars end up in the envelope and are targets ...targets for complement-based killing by anti-alphaGal antibodies. The VSV-G envelope protein is inactivated ... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...experimental species. Discovering ways to culture, propagate, transform, store, and share all of these new ... eat a caterpillar once, vomit, and never do it again. Cichlids (Scott Juntti) Cichlids are 2,000 fish...cephalopods die after they lay their 1 clutch of eggs? Propagation is thus quite difficult. CRISPR genome editing... -
Lab to Office Culture Shock
TypeBlog Post...gut-wrenching, but you can get that feeling of camaraderie again in a non-academic career. You might not be in a ...you still find the idea of not holding a pipette again upsetting, there are ways to get back to the bench...opportunities. You can get your hands in nitrile gloves again! The opportunities are there once you start looking... -
New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression
TypeBlog Post...tryptone, 5 g/L yeast extract, and 5 g/L NaCl) or on LB-agar plates containing glucose and L-arabinose at 37oC...allowing us to reduce the genetic footprint yet again. This also led to improved expression homogeneity...ultrasound imaging. If needed, resort the cells again for improved purity and contrast. For in vivo experiments... -
Plasmids 101: Control Plasmids
TypeBlog Post...every experiment, an investigator needs a standard against which the results can be compared; results from...single experiment wherein Plasmid A (encoding shRNA against human Gene X in backbone Y) was transfected into...included as these provide the baseline/standard against which other samples can be compared. The Empty ... -
March for Science
TypeBlog Post...then revise their hypotheses and the cycle begins again. No part of this process is inherently political...gutting 38 EPA programs: draft budget Science Magazine: A grim budget day for U.S. science: analysis ...analysis and reaction to Trump’s plan Science Magazine: NIH, DOE Office of Science face deep cuts in Trump’s ... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...secondary antibody that recognizes the primary, wash again, then image. But here’s where the “sequential” part...add the new primary, wash, add secondary, image again, inactivate, and repeat these cycles for all your...yourself. If you can’t find a suitable antibody against your target protein, consider fusing a protein ... -
Sequencing Primers
TypeGuide...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 ...AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...AUG1 promoter, reverse primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator...beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse...immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer... promoter, forward primer EF-1a Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a ... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...abilities, we’re gaining new ground in the fight against cancer in its many forms. The dichotomous interactions...sequence of immune reactions that aid in the fight against cancer. Sipuleucel-T by the Dendreon Corporation...will more broadly activate the immune response against tumors. Some chemotherapeutic agents induce immunogenic... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...Distribution Please indicate which strain Addgene should propagate your plasmids in: DH5α, NEB Stable, or ccdB Survival...Survival. Whenever possible, we propagate plasmids in the standard cloning strain DH5α. Please indicate...indicate if your plasmid cannot be propagated in DH5α. For plasmids with highly repetitive sequences (which...