Skip to main content

We narrowed to 400 results for: AGA

Showing: 81 - 100 of 400 results
  1. Luminescent Imaging with Nano-lanterns

    Type
    Blog Post
    ...luminescent imaging a reality, Addgene depositor Takeharu Nagai and colleagues at Osaka University have developed...signal. Since their first publication in 2012, the Nagai laboratory has assembled a collection of multicolored...imaging. Nano-lanterns and your experiments The Nagai laboratory has a done a wonderful job characterizing...
  2. A Look at Addgene's QC Process

    Type
    Blog Post
    ...However, the cloning process — including the propagation of plasmids in bacteria — has many points at ...called Geneious. Here, the raw reads are mapped against a reference sequence, if one was provided. If no...plasmid, and the full QC process is started over again after receiving the replacement plasmid at Addgene...
  3. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ...Please indicate which growth strain Addgene should propagate your plasmids in: DH5α, NEB Stable, ccdB Survival...Survival, Pir1, or other. Whenever possible, we propagate plasmids in the standard cloning strain DH5α. For...choose the Pir1 strain. If your plasmid cannot be propagated in any of these standard strains, choose other...
  4. xCas9: Engineering a CRISPR Variant with PAM Flexibility

    Type
    Blog Post
    ... transcription of gene III, permitting phage propagation and keeping that dCas9 sequence in the pool. ...with BioRender.com. After 24 days of phage propagation, Hu et al. isolated xCas9 1.0-1.4 and subjected...were capable of cleavage, they tested the clones against an NNN PAM library in bacteria where cleavage leads...
  5. Transgenic Organisms, Cas9 Gene Drives, and Appropriate Safeguards

    Type
    Blog Post
    ...spreads through the wild population and immunizes it against the first drive. Laboratories interested in building...question), why not use them whenever applicable?Against this, consider the cost of an accidental release...accidental release could delay real-world applications against scourges such as malaria and dengue for many years...
  6. New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression

    Type
    Blog Post
    ...tryptone, 5 g/L yeast extract, and 5 g/L NaCl) or on LB-agar plates containing glucose and L-arabinose at 37oC...allowing us to reduce the genetic footprint yet again. This also led to improved expression homogeneity...ultrasound imaging. If needed, resort the cells again for improved purity and contrast. For in vivo experiments...
  7. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...lines expressing galactosyl(alpha1-3)galactosyl (alphaGal) sugars were less stable than viruses produced...express these sugars. (Takeuchi et al., 1997). The alphaGal sugars end up in the envelope and are targets ...targets for complement-based killing by anti-alphaGal antibodies. The VSV-G envelope protein is inactivated ...
  8. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...experimental species. Discovering ways to culture, propagate, transform, store, and share all of these new ... eat a caterpillar once, vomit, and never do it again. Cichlids (Scott Juntti) Cichlids are 2,000 fish...cephalopods die after they lay their 1 clutch of eggs? Propagation is thus quite difficult. CRISPR genome editing...
  9. Lab to Office Culture Shock

    Type
    Blog Post
    ...gut-wrenching, but you can get that feeling of camaraderie again in a non-academic career. You might not be in a ...you still find the idea of not holding a pipette again upsetting, there are ways to get back to the bench...opportunities. You can get your hands in nitrile gloves again! The opportunities are there once you start looking...
  10. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...every experiment, an investigator needs a standard against which the results can be compared; results from...single experiment wherein Plasmid A (encoding shRNA against human Gene X in backbone Y) was transfected into...included as these provide the baseline/standard against which other samples can be compared. The Empty ...
  11. March for Science

    Type
    Blog Post
    ...then revise their hypotheses and the cycle begins again. No part of this process is inherently political...gutting 38 EPA programs: draft budget  Science Magazine: A grim budget day for U.S. science: analysis ...analysis and reaction to Trump’s plan Science Magazine: NIH, DOE Office of Science face deep cuts in Trump’s ...
  12. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...secondary antibody that recognizes the primary, wash again, then image. But here’s where the “sequential” part...add the new primary, wash, add secondary, image again, inactivate, and repeat these cycles for all your...yourself. If you can’t find a suitable antibody against your target protein, consider fusing a protein ...
  13. Sequencing Primers

    Type
    Guide
    ...pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice...Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse ...with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse ...CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  14. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...abilities, we’re gaining new ground in the fight against cancer in its many forms. The dichotomous interactions...sequence of immune reactions that aid in the fight against cancer. Sipuleucel-T by the Dendreon Corporation...will more broadly activate the immune response against tumors. Some chemotherapeutic agents induce immunogenic...
  15. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...Distribution Please indicate which strain Addgene should propagate your plasmids in: DH5α, NEB Stable, or ccdB Survival...Survival.­ Whenever possible, we propagate plasmids in the standard cloning strain DH5α. Please indicate...indicate if your plasmid cannot be propagated in DH5α. For plasmids with highly repetitive sequences (which...
  16. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ...approach, which focuses on validating antibodies against markers of the human blood leukocyte populations...on human blood leukocytes, including antibodies against these markers. The 371 CD markers characterized..., and include information on tested antibodies against the target. Helpfully, this also includes clone...
Showing: 81 - 100 of 400 results