Skip to main content

We narrowed to 8 results for: AGA

Showing: 1 - 8 of 8 results
  1. Molecular Biology Reference

    Type
    Guide
    ...GCC, GCA, GCG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine Asn N AAU, AAC Aspartic Acid Asp ...allow for the propagation of the plasmid within bacteria, while allowing for selection against any bacteria...bacteria with plasmids, thus selecting against the propagation of these plasmids through cell division...lab. Regardless of type, plasmids are generally propagated, selected for, and their integrity verified prior...cloning techniques . Common Bacteria Strains for Propagating Plasmids E. coli are gram-negative, rod-shaped...which antibiotic(s) to add to your LB media or LB agar plates. For more information on growing bacterial...These attached DNA templates are then amplified again, producing ~1,000 copies of each template. Each ...
  2. Sequencing Primers

    Type
    Guide
    ...pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice...Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse ...with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse ...CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  3. Antibody Guide

    Type
    Guide
    ...which is immobilized on agarose or magnetic beads. Using centrifugation (for agarose beads) or a magnet (...developed, the antibodies are collected, tested against the antigen, packaged, and sold. This is the most...unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic... directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs...materials. There are two primary methods used, using agarose or magnetic beads, but both rely on the same general...most or all of their extracellular matrix removed. Again, the signaling molecule may be a fluorophore or ...or more conjugated primary antibodies, and wash again. Use controls to identify, or gate, cells by size...
  4. Adenovirus Guide

    Type
    Guide
    ... used viral vector platform for vaccine design against a diversity of viruses. This guide contains many...this, and to the strong host’s immune response against the transduced cells, transgene expression delivered...mammalian hosts and have been used as vaccines against infectious diseases such as COVID-19, Ebola virus... immunity to Ad5 and protect nonhuman primates against ebolavirus challenge . Journal of Virology, 85 ...) PMID: 17546019 (Link opens in a new window) Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector...
  5. CRISPR Guide

    Type
    Guide
    ...systems that bacteria and archaea use to protect against these foreign nucleic acids. Acr family members...3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s..., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., ...: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome ...
  6. Modular Cloning Guide

    Type
    Guide
    ...Acinetobacter spp. and Acinetobacter baumannii . Komagataeibacter Tool Kit (KTK) Bacterial Expression Tom Ellis...constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-GG-Kit Bacterial Expression...
  7. Chemogenetics Guide

    Type
    Guide
    ...olanzapine has also been shown to be an agonist against hM4Di, and is especially attractive for use in .../doi.org/10.1126/science.aav5282 PMID: 30872534 Nagai, Y., Miyakawa, N., Takuwa, H., Hori, Y., Oyama, ...
  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...Saccharomyces cerevisiae , often by fusion to the Aga2p protein. This platform supports the correct folding...
Showing: 1 - 8 of 8 results