Skip to main content

We narrowed to 94 results for: MPI

Showing: 81 - 94 of 94 results
  1. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...partner regulatory domains. The Chodera Lab recently compiled the Human Kinase Domain Constructs Kit, a library...
  2. Sequencing Primers

    Type
    Guide
    ... Forward Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...
  3. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog). Due to the long terminal...ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection of pLKO.1 plasmid... agar) American Bioanalytical: #AB01200-02000 Ampicillin VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin...colonies from each ligation into LB + 100 μg/mL ampicillin or carbenicillin. Day 2: 2. Spin down the cultures...Autoclave and cool to 55°C. Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration...
  4. Pouring LB Agar Plates

    Type
    Protocol
    ...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Bleocin 5 mg/mL 5 µg/mL Carbenicillin...dH 2 O. *Carbenicillin can be used in place of ampicillin. Carbenicillin is more stable, so it is potentially...plates with a final concentration of 100 ug/mL ampicillin, you should make a stock solution of 100,000 .../mL (100 mg/mL). Simply measure out 100 mg of ampicillin powder, add it to 1 mL of water, dissolve by ...
  5. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...Commonly Used Antibiotics Recommended Concentration Ampicillin 100 µg/mL Bleocin 5 µg/mL Carbenicillin 100 µg...
  6. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...primary antibody to use will vary and needs to be empirically determined. If possible, run an initial test ...antibody concentration will vary and needs to be empirically determined. We suggest starting with three concentrations...curve will vary between targets and needs to be empirically determined. The dilution series created in section...
  7. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...required for effective over-agar selection has been empirically determined. See selection curve below. Carbenicillin...Carbenicillin is used here in place of ampicillin because carbenicillin is more stable, so it is potentially...
  8. General Transfection

    Type
    Protocol
    ...optimal mass DNA:mass PEI ratio will need to be empirically determined for each new batch of 1 mg/mL PEI ...Pro-Tip The ratio of µg DNA:µg PEI needs to be empirically determined. Once a batch of PEI is prepared, ...
  9. Protocol - Bacterial Transformation

    Type
    Protocol
    ...containing agar plate. This step is not critical for Ampicillin resistance but is much more important for other...heat-shock Shorten or skip the outgrowth (for Ampicillin resistance it is ok to completely skip the outgrowth...
  10. Lentivirus Production

    Type
    Protocol
    ...optimal mass DNA:mass PEI ratio will need to be empirically determined for each new batch of 1 mg/mL PEI ...therefore the ratio of μg DNA:μg PEI needs to be empirically determined. Once a batch of PEI is prepared, ...
  11. Colony Formation Titering Assay

    Type
    Protocol
    ...required to kill your target cell line needs to be empirically determined. Treat the target cells with a range...
Showing: 81 - 94 of 94 results