We narrowed to 1,036 results for: STI
-
TypeProtocol...follows: Remove the gel from the plastic packaging. Remove tape and plastic comb. Rinse the wells with deionized...well microtiter plate Chemiluminescence substrate Plastic wrap Primary antibody Secondary antibody Deionized... white separator. Keep the Bottom Stack in the plastic tray. Place the Bottom Stack on the blotting surface...for 5 min at RT . Cover the membrane with clear plastic and use a gel imager with chemiluminescence detection...
-
Cre-lox system
TypeCollection...Eisenhoffer 131783 pTol2-CreLite CreLite; Tol2 destination vector with mTagBFP2 Zebrafish Eisenhoffer 131785...constructs Cre-loxP recombination is used to create a stochastic choice of expression among fluorescent proteins...indelible marking of mouse neurons with multiple distinct colors Mammalian Sanes See article Multibow constructs...which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to maximize....0403954101. Epub 2004 Jul 6. PubMed . Do you have suggestions for other plasmids that should be added to this... -
AAV Viral Preps
TypeCollection...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction... -
Mammalian RNAi Tools
TypeCollection...interference (RNAi) experiments at Addgene; browse by constitutive lentiviral shRNA, cre-regulated lentiviral shRNA... silencing mechanism. It is a useful tool to investigate the roles of specific genes or to knockdown genes...retroviral and AAV backbone options. Plasmids for constitutive expression as well as those that allow for conditional... -
Trimmer Lab NeuroMab Collection
TypeCollection...NPY2R Human Mouse IgG2a 177465 Anti-Collybistin [L120/30R] Collybistin Rat Mouse IgG2a 177466 Anti-nNOS/...Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin [L120/12R] Collybistin Rat Mouse IgG2a 182096 Anti-Kv2.1...IgG2a 225365 Collybistin (Rattus norvegicus) recombinant monoclonal antibody. Collybistin Rat Mouse IgG2a...BAIAP2 Human Mouse 190507 Collybistin scFv [L120/12] L120/12 scFv Collybistin Rat Mouse 190508 Bassoon ...R-mAbs have been engineered such that they are a distinct IgG subclass from the conventional mAb to facilitate... -
Synthetic Biology - Overview
TypeCollection...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...ethical synthetic biology JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this... -
Worm Expression Resources
TypeCollection...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...molecular biology, plasmid cloning, and titering and testing your viral preparations. ...free to email us at [email protected] with any questions. Intro to the Lab Bench Introductory techniques...your plasmids. Virus Protocols for titering and testing your virus preparations. Antibodies Protocols for...Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic Restriction Digest Verify a plasmid using restriction... -
Validated gRNA Sequences
TypeCollection...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control... -
Gibson Assembly Protocol
TypeProtocol... Gibson and colleagues at the J. Craig Venter Institute developed a novel method for the easy assembly...the assembled parts. Tips and Troubleshooting “Stitching” fragments together using oligos When you need...sequence between two PCR products, one method is to “stitch” together several oligos. This technique is especially...Pro-Tip Please note that the way to design the “stitching” primers and the amounts of primers to include... -
Lentivirus Production
TypeProtocol...controller Hazardous waste container pH meter Stir plate Magnetic Stir Bar Reagents DMEM high glucose, Corning... of powder in 100 mL of deionized water. While stirring, slowly add hydrochloric acid until the solution...any packaging cells that were collected during harvesting. Filter supernatant through a 0.45 μm PES filter... -
Using a Light Microscope Protocol
TypeProtocol...allows you to distinguish objects within the sample. You can increase contrast by a) adjusting the aperture.... You can take entire courses on microscopy and still have more to learn, so, for this protocol, we'll...image larger) and resolution (the ability to distinguish between two discrete objects). Figure 1 depicts... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms... -
Protocol - How to Run an Agarose Gel
TypeProtocol...details on doing diagnostic digests and how to interpret them please see the Diagnostic Digest page. Purifying... how to perform gel electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light...the solution heats up.). Caution HOT! Be careful stirring, eruptive boiling can occur. Pro-Tip It is a good... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable cell culture...untransduced cells, resulting in a more homogenous (but still polyclonal) cell population. Depending on the transducibility...Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete: 10% v/v FBS...lentiCas9-Blast and then selected with 1 µg/mL blasticidin for 9 days. Single cells were then plated in... -
CRISPR Plasmids - Tagging
TypeCollection...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this... -
Retrograde AAV viral preps
TypeCollection...construct from Alla Karpova at Janelia Research Institute....staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova... -
CRISPR Library Amplification
TypeProtocol...later. At a minimum we recommend the use of a diagnostic digest and high-throughput next generation sequencing...plasmid backbone a single time and visualize that digestion on an agarose gel ( see restriction digest protocol... Transform, recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed...limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 hours) Cells should be harvested first... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...For small deletions (as the “deletion band” may still amplify), resolve agarose gel to determine if size...for 20 min). These cycling conditions allow for digestion and ligation to occur in one reaction (see step...conditions for each primer pair designed based on testing the bulk sorted cells. Run samples on 2% agarose... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...Mutation Libraries 229137–229140 Donor Vector Human Stiewe N/A Varies 1,910–3,034 per exon Human Cas13 lncRNA...69,716 SAM v2 - 2 plasmid system 1000000078 (Blasticidin) Activation Human Zhang 3rd 3 70,290 sgRNA libraries...