Skip to main content

We narrowed to 16 results for: STI

Showing: 1 - 16 of 16 results
  1. Promoters

    Type
    Guide
    ...to drive constitutive or inducible expression. Promoter Expression Description T7 Constitutive Promoter...polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive Promoter...tryptophan operon Ptac Constitutive Hybrid promoter of lac and trp; constitutive in the absense of lac ...Drosophila Polyhedrin Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong...promoter CMV Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian... alpha PGK Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian ...) CaMV35S Constitutive Plant Strong promoter from Cauliflower Mosaic Virus Ubi Constitutive Plant High-expression...
  2. Optogenetics Guide

    Type
    Guide
    ...way to stimulate the activity of a particular GPCR is to engineer a chimeric protein consisting of an ...other fragment to CIB1, light-stimulated heterodimerization can reconstitute the protein. This principle... 450 OPTOSTIM PHR domain of CRY2 from A. thaliana is fused to truncated forms of cytosolic STIM1 to control...neurons upon exposure to light through direct stimulation of ion channels. Naturally occurring channelrhodopsins... nonspecific cation influx into the cell when stimulated. Channelrhodopsin-2 (ChR2), the first widely ...domains from two different ChRs. These ChR variants still function as light-gated cation channels resulting...physiological processes in response to specific stimuli. In fact, the animal GPCRs responsible for vision...
  3. Molecular Cloning Techniques

    Type
    Guide
    ...oligonucleotide stitching, in which pieces of DNA that share no homology ends can still be fused in a seamless...Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources Molecular cloning, or the creation of...containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ends). Two pieces ...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...bacterial recombination to easily move it into any destination plasmid that fits your experimental goal. Although... Gateway donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection...
  4. Antibody Guide

    Type
    Guide
    ...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...
  5. CRISPR Guide

    Type
    Guide
    ...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Publications CRISPR Overview Bacteria have an interesting adaptive immune response that detects and eliminates...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional..., a large portion of the Cas9-induced DSBs will still be repaired via NHEJ. The resulting population of...integrase landing site ( attB ) and the other to stimulate DNA repair. This can result in more efficient ...activity. Knockout libraries often target 5′ constitutively expressed exons, while activation and repression...repression, many CRISPR epigenetic tools require constitutive expression of the dCas9 fusion and/or expression...
  6. Plan Your Experiment

    Type
    Guide
    ...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High...
  7. Chemogenetics Guide

    Type
    Guide
    ...) Human M3 muscarinic Arrestin-2/-3 CNO Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins..., M. E., Lu, D., Barter, J. W., Rossi, M. A., Augustine, G. J., Yin, H. H., & Hochgeschwender, U. (2016...
  8. Adenovirus Guide

    Type
    Guide
    ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...creating first-generation rAdV vectors, which is still the most commonly used generation for research purposes...greater ability to avoid vector-neutralizing pre-existing immunity. Pseudotypes Pseudotyping is the process...developed a serotype-specific immune response. Preexisting immunity lowers viral vector uptake and transgene...vectors are also being used in cancer therapy to stimulate anti-tumor immune response in different ways, ...high titers for their use in experiments. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AdV research. ...
  9. Lentiviral Vector Guide

    Type
    Guide
    ...the required components have been separated into distinct plasmids for safety. For a summary of all lentiviral...replicate on their own. While the viral components are still separated on different plasmids, the viral genome...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...knowing the general preference for integration, it is still random and difficult to predict. In therapeutic ...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to lentiviral-related...
  10. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending on cell type...for the treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant... splice site donor and acceptor sequences to reconstitute the two pieces of the transgene. The first vector...delivery of larger transgenes, but expression is still much less efficient than with a single rAAV vector...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AAV-related research...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...these required components have been separated into distinct plasmids for safety to reduce the chance of creating...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to gamma-retroviral-related...10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H....Some newer plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates...
  12. Molecular Biology Reference

    Type
    Guide
    ...thousand base pairs from the entire human genome. Digesting the human genome with restriction enzymes would...are now used for a variety of studies used to investigate promoters, small RNAs, and other genetic elements...enabling easy insertion of DNA by restriction enzyme digestion and ligation. As a general rule, the restriction...gram-negative, rod-shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally...over multiple generations. It is important to distinguish that the antibiotic resistance gene is under ...with a different fluorophore so they can be distinguished from one another. These tagged dNTPs also lack...is not 100% efficient and the machine cannot distinguish between the four labeled nucleotides, or in biologically...
  13. Modular Cloning Guide

    Type
    Guide
    ...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...Expression Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...Takashi Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate...
  14. Sequencing Primers

    Type
    Guide
    ...’s protocol to design your own primers . Still have questions about choosing the best primer for your ...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA...
  15. Guide to Using Pooled Libraries

    Type
    Guide
    ... target genes or regulatory regions, where it stimulates transcription by recruiting activators or modifying...protocol for the best results. If you have any questions about the library protocols, feel free to contact...outline for using lentiviral gRNA libraries in postivie or negative screens. The use of appropriate controls...
  16. Science Guides

    Type
    Guide
    ...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...
Showing: 1 - 16 of 16 results