We narrowed to 15 results for: STI
-
TypeGuide...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...
-
Optogenetics Guide
TypeGuide...the other half to CIB1, light-stimulated heterodimerization can reconstitute the protein. This principle...examples of relevant variants. This list is not exhaustive - please browse our curated list of opsins here...neurons upon exposure to light through direct stimulation of ion channels. Naturally occurring channelrhodopsins... nonspecific cation influx into the cell when stimulated. Channelrhodopsin-2 (ChR2), the first widely ...domains from two different ChRs. These ChR variants still function as light-gated, cation channels resulting...Chronos High-speed, light-sensitive channel from Stigeoclonium helveticum 500 Chrimson, ChrimsonR Red-light...population, or activate different neural populations at distinct times. Temporal considerations. Temporal precision... -
Cloning
TypeGuide...oligonucleotide stitching, in which pieces of DNA that share no end homology can still be fused together...Gibson Type IIS Ligation Independent Cloning Oligo Stitching Molecular cloning or the creation of recombinant...containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ends). Two pieces ...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase...clonase enzymes. Thousands of Gateway® destination plasmids have been made with different promoters, tags...are two-fold. First, the entire cloning step (digestion and ligation) can be carried out in one reaction... -
CRISPR Guide
TypeGuide...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Publications CRISPR Overview Bacteria have an interesting adaptive immune response that detects and eliminates...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional..., a large portion of the Cas9-induced DSBs will still be repaired via NHEJ. The resulting population of...integrase landing site ( attB ) and the other to stimulate DNA repair. This can result in more efficient ...activity. Knockout libraries often target 5′ constitutively expressed exons, while activation and repression...repression, many CRISPR epigenetic tools require constitutive expression of the dCas9 fusion and/or expression... -
Plan Your Experiment
TypeGuide...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High... -
Chemogenetics Guide
TypeGuide... Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins...Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U (2016). Luminopsins... -
Promoters
TypeGuide...Description CMV Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian... factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter ...Description T7 Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires...Inducible Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression... simpler than eukaryotic transcription bacteria still have complex systems of gene regulation, like operons...polymerase Promoter from Sp6 bacteriophage lac Constitutive in the absense of lac repressor (lacI or lacIq... -
Molecular Biology Reference
TypeGuide...thousand basepairs from the entire human genome. Digesting the human genome with restriction enzymes would...amplified) by bacteria, which is an important characteristic of why plasmids are convenient and easy to ...survive antibiotic treatment. It is important to distinguish that the antibiotic resistance gene is under ... easy insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS ...can be used for cloning by restriction enzyme digestion. For more information about restriction enzymes...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements...gram-negative, rod shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally... -
Adenovirus Guide
TypeGuide...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...creating first-generation rAdV vectors, which is still the most commonly used generation for research purposes...greater ability to avoid vector-neutralizing pre-existing immunity. Pseudotypes Pseudotyping is the process...developed a serotype-specific immune response. Preexisting immunity lowers viral vector uptake and transgene...vectors are also being used in cancer therapy to stimulate anti-tumor immune response in different ways, ...high titers for their use in experiments. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AdV research. ... -
Lentiviral Vector Guide
TypeGuide...the required components have been separated into distinct plasmids for safety. For a summary of all lentiviral...replicate on their own. While the viral components are still separated on different plasmids, the viral genome...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...knowing the general preference for integration, it is still random and difficult to predict. In therapeutic ...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to lentiviral-related... -
Adeno-associated virus (AAV) Guide
TypeGuide...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending on cell type...for the treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant... splice site donor and acceptor sequences to reconstitute the two pieces of the transgene. The first vector...delivery of larger transgenes, but expression is still much less efficient than with a single rAAV vector...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AAV-related research... -
Gamma-Retroviral Vector Guide
TypeGuide...these required components have been separated into distinct plasmids for safety to reduce the chance of creating...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to gamma-retroviral-related...10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H....Some newer plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates... -
Modular Cloning Guide
TypeGuide...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...Expression Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...Takashi Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate... -
Sequencing Primers
TypeGuide...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA... sequencing primer" and "3' sequencing primer". Still not sure what primer you need? Email us at help@... -
Science Guides
TypeGuide...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...