We narrowed to 92 results for: mpi

... Forward Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...

...agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog). Due to the long terminal...ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection of pLKO.1 plasmid... agar) American Bioanalytical: #AB01200-02000 Ampicillin VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin...colonies from each ligation into LB + 100 μg/mL ampicillin or carbenicillin. Day 2: 2. Spin down the cultures...Autoclave and cool to 55°C. Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration...

...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Bleocin 5 mg/mL 5 µg/mL Carbenicillin...dH 2 O. *Carbenicillin can be used in place of ampicillin. Carbenicillin is more stable, so it is potentially...plates with a final concentration of 100 ug/mL ampicillin, you should make a stock solution of 100,000 .../mL (100 mg/mL). Simply measure out 100 mg of ampicillin powder, add it to 1 mL of water, dissolve by ...

...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...Commonly Used Antibiotics Recommended Concentration Ampicillin 100 µg/mL Bleocin 5 µg/mL Carbenicillin 100 µg...

...primary antibody to use will vary and needs to be empirically determined. If possible, run an initial test ...antibody concentration will vary and needs to be empirically determined. We suggest starting with three concentrations...curve will vary between targets and needs to be empirically determined. The dilution series created in section...

...required for effective over-agar selection has been empirically determined. See selection curve below. Carbenicillin...Carbenicillin is used here in place of ampicillin because carbenicillin is more stable, so it is potentially...

...optimal mass DNA:mass PEI ratio will need to be empirically determined for each new batch of 1 mg/mL PEI ...Pro-Tip The ratio of µg DNA:µg PEI needs to be empirically determined. Once a batch of PEI is prepared, ...

...containing agar plate. This step is not critical for Ampicillin resistance but is much more important for other...heat-shock Shorten or skip the outgrowth (for Ampicillin resistance it is ok to completely skip the outgrowth...

...optimal mass DNA:mass PEI ratio will need to be empirically determined for each new batch of 1 mg/mL PEI ...therefore the ratio of μg DNA:μg PEI needs to be empirically determined. Once a batch of PEI is prepared, ...

...required to kill your target cell line needs to be empirically determined. Treat the target cells with a range...

...DNA:PEI may vary significantly and should be empirically determined for your sample. Typical ratios may...

... medium throughout experiments be determined empirically, and that the cell population be monitored regularly...