Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 916 results for: tro

Showing: 81 - 100 of 916 results

  1. Serotype Testing AAV

    Type
    Collection
    ...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype ...fluorescent reporters and can be used to compare the tropism of different serotypes. In addition to the standard...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...AAV9 37825-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP...AAV9 50465-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 50465-AAVrg.T 20 µL $ 140 Add to Cart *Each viral...

  2. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  3. AAV Viral Preps

    Type
    Collection
    ... of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 8, 9 and retrograde Retrograde AAV...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...

  4. Plan Your Experiment

    Type
    Collection
    ...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...

  5. AAVED

    Type
    Collection
    ...targeted neuronal manipulation (aka intersectional control). The end result of the meeting will be a publicly... AM Cre and Flpo Katherine Matho 10:15 AM AAV Retrograde Tracing Gowan Tervo and Sarada Viswanathan 11...tips for using the technology in the lab (e.g., controls to perform, recommended histology conditions, ... examples of AAV strategies for intersectional control. Please see our list of suggested materials below...of research materials to share: In vivo data: Retrograde hSyn1-GCaMP6f-P2A-nls-dTomato Detailed protocol...reference for AAV use in neuronal intersectional control. Through your participation in this meeting, you...

  6. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...study the development and function of zebrafish astrocytes. Knock-in tagging - Michel Bagnat lab. Targeting...

  7. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...intracerebroventricular (ICV) delivery in newborns, and retro-orbital (RO) and stereotaxic (STX) delivery in adult...minBG-SYFP2-WPRE3-BGHpA AiP14470 AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531...minBG-SYFP2-WPRE3-BGHpA AiP12558 AiE0390m_3xC2 SYFP2 Astrocytes Whole Brain 208163 pAAV-AiE0390m_3xC2-minBG-iCre...-iCre(R297T)-BGHpA AiP14801 AiE0390m_3xC2 Cre Astrocytes Whole Brain 208143 pAAV-AiE0390h_3xC2-minBG-SYFP2...minBG-SYFP2-WPRE3-BGHpA AiP13572 AiE0390h_3xC2 SYFP2 Astrocytes Whole Brain 208133 pAAV-AiE0387m-minBglobin-SYFP2...-SYFP2-WPRE3-BGHpA AiP12102 AiE0387m SYFP2 Astrocytes Whole Brain 208166 pAAV-AiE0387m-minBG-iCre(R297T...R297T)-BGHpA AiP13999 AiE0387m Cre Astrocytes Whole Brain 220643 pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357...

  8. TALEN Plasmids and Kits

    Type
    Collection
    ...expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7...promoter. RCIscript-GoldyTALEN is designed for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus...of the DNA-binding domain of a TALE, along with strong nuclear localisation tags and repress transcription... T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which ... included for generating TALEN mRNAs through in vitro transcription as an alternative. Based on transient...

  9. Neurodegeneration Research Collection

    Type
    Collection
    ...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...being adopted in the field. Read on for a brief introduction to the genetics associated with some of the ...Symptoms include changes in behavior and emotion, uncontrolled movements, memory deficits, as well as difficulty...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...

  10. Optogenetics Plasmid Collection

    Type
    Collection
    ...Optogenetics plasmids encode proteins that are controlled by light. Many of these plasmids encode for microbial...the cell. When using these opsins as a tool to control neuronal activity, scientists generally attach ...localization. Many other types of proteins can also be controlled by light, generally by utilizing a light sensitive...fusions can then be used as an optical switch to control protein interactions, dimerization, localization...the table below for plasmids that use light to control a protein or cellular activity. For example, search...

  11. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... In vitro transcription none, need Cas9 plasmid Boxem 47912 SP6-sgRNA-scaffold SP6 AflII In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid Joung 46170...

  12. AAV for Neuronal Tracing

    Type
    Collection
    ...viral service encoding tools for monosynpatic retrograde neuronal tracing, to be used with modified rabies...be used with modified rabies virus to perform retrograde neuronal tracing. Note : Addgene does not distribute... pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies Virus-based Monosynaptic Tracing The...-deleted rabies to specific starter cells, the tropism of this virus was modified so that it could only..., Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde neuronal tracing with a deletion-mutant rabies...

  13. CRISPR References and Information

    Type
    Collection
    ...wide range of organims. Developed by the Michael Boutros Lab . CasFinder: Flexible algorithm for identifying...107 KB Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized...Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP)... packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library...lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for...

  14. Optogenetics AAV Preps

    Type
    Collection
    ... Optogenetics AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? ...

  15. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian/in vitro transcription BsaI none S. pyogenes Mark pU6T7 71462 Mammalian/in vitro transcription...pyogenes Luikart pRubiG-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP Luikart...Luikart pRubiC-T2A-Cas9 75347 Mammalian/Retroviral from pXL yes, activate S. pyogenes mCherry Luikart pDECKO_mCherry...Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with up to 3 ...in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG ...

  16. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...Cut Fully functional Cas9 enzymes designed to introduce a double-strand break (DSBs) at a specific location...high homology to the DNA surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell...error-prone than NHEJ and can be used to faithfully introduce specific genomic changes. ID Plasmid Gene/Insert...NGG) 51306 pUC57-Simple-gRNA backbone T7 BsaI In vitro transcription none, need Cas9 plasmid Chen Do you...

  17. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...BsmBI In vitro transcription none, need Cas9 plasmid Chen and Wente 42250 DR274 T7 BsaI In vitro transcription... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...

  18. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... store a record of invading phages but also to destroy the phages upon re-exposure. More specifically,...complex binds to the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview...could be programmed for targeted DNA cleavage in vitro. In 2013, Cong et al. and Mali et al. described ...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s ...Weissman JS. 2014. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell . 159(3...

  19. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...HIV-based lentiviral particles Murine leukemia-based retroviral particles Vesicular stomatitis virus particles...Description Mutations Industry PI Due to export control regulations, MERS and SARS-CoV materials are available...Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids...vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase...

  20. Recombinases AAV Preps

    Type
    Collection
    ...8, rg* Deisseroth *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from the Karpova...site-specific recombinases, which can be used to control gene expression. See our Cre-lox Plasmids page ...Karpova and Schaffer labs. See the Retrograde AAV Inventory Page . Don’t See What You’re Looking For? ...
Showing: 81 - 100 of 916 results