We narrowed to 1,019 results for: CAL;
-
TypeProtocol...the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the pellet get too ...
-
Adeno-associated Viruses (AAVs) for Genome Editing
TypeBlog Post...frequency three orders of magnitude higher than identical targeting vectors delivered through transfection... -
Filming Science Videos in the Age of Social Distancing
TypeBlog Post...focus or zoom on a camera lens without having to physically rotate the rings around the lens. It allowed ... -
10 Steps to a Perfect Science Talk
TypeBlog Post...had been more careful. 3. Tell a story We are biologically programmed to listen and remember better when... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...genes are signified with a minus sign (-) as is typically standard; just having the gene listed indicates... -
Plasmids 101: Repressible Promoters
TypeBlog Post...natural and engineered repressible promoters. Chemically repressible promoters Tet-Off In its native context... -
Modular Cloning Guide
TypeGuide...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...Assembly Kit Bacterial Expression Christopher A. O'Callaghan Toolkit for assembling large DNA fragments based...and Multisite Gateway cloning. This system was specifically designed for generating zebrafish transgenesis... -
Addgene's eBook Collection
TypeGuide...2021 | Third Edition About This eBook covers practical experimental advice such as tips for planning ... on FRET, biosensors, and monitoring protein localization; an introduction to non-protein fluorophores...First Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based... -
Guide to Using Pooled Libraries
TypeGuide...Genome-Scale, Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional...plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library screens can... -
Adenovirus Guide
TypeGuide...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...contain E4. Download the Bert Vogelstein’s lab practical guide for using the AdEasy™ system . Find plasmids...packaging cell line. Recombinant adenoviral vectors typically do not integrate in the host genome and instead... -
Sequencing Primers
TypeGuide...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward... -
Cloning
TypeGuide...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...TOPO Cloning ) Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies... -
DNA Quantification
TypeProtocol...Calculate your DNA sample concentration and purity using Addgene’s DNA Quantification Protocol.... -
Protocol - How to Design Primers
TypeProtocol... template region of DNA. They are synthesized chemically by joining nucleotides together. One must selectively... -
Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs
TypeProtocol...so at your own risk; you should ensure that any local guidance is also adhered to. None of the authors... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol...added when ordering them or can be performed enzymatically later. Experimental Procedure Digest and purify... -
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...restriction enzymes cleave DNA at specific sequences called restrictions sites. Often, the size of the plasmid... -
AAV Purification by Iodixanol Gradient Ultracentrifugation
TypeProtocol... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... -
Science Guides
TypeGuide...Chemogenetics Chemogenetics is a technique that uses genetically engineered receptors to selectively control and...