We narrowed to 1,085 results for: IND

...scientific concepts related to our plasmid collection. Find links to the guides below. Antibodies Chemogenetics...antibodies are proteins capable of highly specific binding to other proteins. Antibody-based applications,...2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an adaptive...bacteria, have been modified for genome engineering. Find essential background information on CRISPR and the...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the different...

...Find a list of universal sequencing primers and other common sequencing primers.... that may be useful in your sequencing reaction, find your plasmid’s page and see what primers are listed... N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end...LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA ...

...stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are...sorted cells are expanded into a cell line. You can find more information in Addgene’s stable cell line protocol...Day, W., Stevenson, E., Madigan, M., Chen, J., Khinder, R., . . . Pule, M. (2022). Efficient clinical-...Immunogenicity The ability of a molecule or substance to induce an immune response in the body. in cis In the context...Figures created with BioRender (Link opens in a new window) Last Updated Content last reviewed on 9 June 2025...

...Information Molecular Cloning Techniques Protocols Find written and video protocols for a wide range of ...

... | First Edition About In this eBook, you’ll find tips for choosing a fluorescent protein; information...