We narrowed to 405 results for: AGA

...would make it easier for an “escape” virus to propagate and infect adjacent cells. It will be important...Zhang Y, Yin C, Zhang T, Li F, Yang W, Kaminski R, Fagan PR, Putatunda R, Young WB, Khalili K, Hu W. CRISPR...

....org/10.1038/nn.4593  Dhungel, B. P., Xu, H., Nagarajah, R., Vitale, J., Wong, A. C. H., Gokal, D., Feng...Diep, J., Ishikawa, Y., Jae, L. T., Wosen, J. E., Nagamine, C. M., Chapman, M. S., & Carette, J. E. (2016...

... experimental (?) groups were run on a western against a protein standard (P) to check for tau molecular...antibody specificity is to test the primary antibody against wild-type and knockout samples. In this test, wild-type...

...light-driven pumps that pass ions (Cl-, H+, Na+) against the concentration gradient and hyperpolarize the...activation inhibitory (ArCH) proton pump passing ions against the concentration gradient. Created with BioRender.com...

....2009.169 Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette, J. E., & ...Moullier, P. (2002). Lack of an Immune Response against the Tetracycline-Dependent Transactivator Correlates...

... Remove air bubbles between the membrane and the agar using forceps. Several protein induction conditions...detect bound cells, simply lay each membrane on an agar plate selective for your target organism and incubate...

...voltage difference across a gel matrix (usually agarose) to pull your negatively charged DNA through the...enzymes you used for cloning. Run your digest on an agarose gel. You should see two bands, one the size of ...

... to screen the NCC-1 library of approved drugs against the entire kit; a parallel analysis that successfully...every plasmid or as individual plasmids shipped as agar stabs. Iverson, et al. ACS Synth Bio. 2015. PubMed...sgRNA expression vectors (containing ten guides against each of the 8,158 predicted T. gondii protein-coding...

...and Red (ReNL; plasmid #85203) NLuc fusions. The Nagai lab has additionally deposited more than 25 fusions...27786307. PubMed Central PMCID: PMC5476805. 8. Inagaki, S., et al. (2017) Genetically encoded bioluminescent...

...the DNA backbone that contains a target sequence against the fluorescent reporter in an inverted repeat ...hairpin dsRNA is produced that contains sequence against your gene(s) of interest and the reporter. This...

...signal in these assays (Dempster et al., 2019). Again, the experimental strategy is clear: for any gene...0059-1 Veres A, Gosis BS, Ding Q, Collins R, Ragavendran A, Brand H, Erdin S, Cowan CA, Talkowski ME, ...

...These strategies use multiple, unique antibodies against the same protein, each targeting a different epitope...correlation between the results. Using antibodies against different epitopes on the same target reduces the...

...animal, and its B cells will churn out antibodies against the injected protein. Several weeks later, blood...protein. However, each animal will make antibodies against different protein epitopes and so variability between...

... create a thin sheet of excitation light that propagates perpendicular to an imaging objective that collects...excitation light is completely reflected, energy is propagated into the sample via an evanescent wave that only...

...receptor are stained with a fluorescent antibody against the receptor and analyzed on a flow cytometer. ...methods. In direct staining, the primary antibody against a target is conjugated to a fluorochrome. In indirect...

...multiplexing of sgRNAs against unique genomic targets or multiple sgRNAs against the same target to ensure...

...steps and the joined modules cannot be separated again by the same cloning enzymes. MXS (MluI-XhoI-SalI...properties, they generated monoclonal antibodies against them, fused them to GFP, and compared them to popularly...In order to overcome these limitations, Takeharu Nagai and colleagues at Osaka University have developed...

...affordably in bacteria. They are compatible with both agarose and polyacrylamide gels. They are shared through...utilize CRISPR Cas9 systems to defend themselves against bacteriophage infection, but some phages fight ...

...increase the chances of inducing an immune response against the capsids or transgenes. Sensory neurons and ... is not neutralized by pre-existing antibodies against AAV9-based vectors (and vice versa), enabling repeat...

...even win a $500 travel prize in our open data extravaganza!  Anyone can submit data from their CLOVER...

...creative scientists will deliver some fabulous photos again this year! Why #DecktheLab? Help us spread some...

...pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice...Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse ...with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse ...CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...

... community lab in Cambridge, MA, for hosting our agar art fun!...

... the viral service, and now we’re “going viral” again! #AddgeneGoesViral on Twitter Starting today, our...

...the bacteria are inoculated over a quadrant of an agar plate. Then, a stick is dragged through the first...

...this holiday season! It is that time of the year again: miniature #Christmas tree goes up at home!This ...

...ever before. 29:54 - 31:25 : Nature's defenses against gene drives. 31:26 - 33:08 : Plans for future work...

...was no less busy for the Addgene blog which once again had record readership with over 75,000 views. Changing...

...sophisticated interactions with multiple other proteins. Again, little to no change in cell morphology was observed...

...plating if your transformed cells are being plated on agar with ampicillin selection.  Notes and tips  We’...