We narrowed to 399 results for: POR C
-
TypeCollection...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...
-
Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens
TypeBlog Post...to fuse the activators instead of at the protein’s C terminus. With that new design in place, Konermann...Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...nucleolytically inactive Cas9-VP64 fusion; 2. A sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop...knockout screening). As the Zhang lab's Nature paper reports, “Here we have shown that the SAM system is robust...size of the backbone, transformations require electroporation. References & Further Reading: For more ... -
CRISPR 101: Non-Homologous End Joining
TypeBlog Post...Oh S, Tomkinson AE, Hendrickson EA, Giovannangeli C, Jasin M, Brunet E (2014) Chromosomal Translocations.../10.1016/j.molcel.2014.08.002 Ran FA, Hsu PD, Lin C-Y, Gootenberg JS, Konermann S, Trevino AE, Scott DA... Yan M-Y, Li S-S, Ding X-Y, Guo X-P, Jin Q, Sun Y-C (2020) A CRISPR-Assisted Nonhomologous End-Joining...process involve repairing chromosomal DSBs. It is important to know that cells possess two major repair pathways...chance of causing a frameshift mutation. Of some importance, the deletion can be less heterogeneous when ... -
Deep Dive: qPCR
TypeBlog Post...Annealing temperature should be 60-65°C For qPCR, the important primer variable is the annealing temperature... the primers. Melting temperature should be ~60°C (between 50 and 65, with no more than 3 degrees between...curve will show multiple peaks. (a) (b) (c) Fig. 1: Melt curves showsing (a) a single peak...dimers. (b) A shoulder peak indicating primer dimers. (c) A double peak indicating 2 amplicons. Image credits...02217-xTaylor, SC; Nadeau, K; Abbasi, M; Lachance, C; Nguyen, M; Fenrich, J. The Ultimate qPCR Experiment...Zuo J, Dong X, Zhang M, Hu G, Fang F. Fudenine, a C-terminal truncated rat homologue of mouse prominin...step. Scorpion chemistry in particular has been reported to work well in the Lightcycler while being relatively... -
Live and Let Dye: Self-Labeling Protein Tags
TypeBlog Post...mDia1 and CP appearance at the filament tip from (a). c) Intensity traces at the tip of the filament from ...10.1021/cb900062k Gautier, A., Juillerat, A., Heinis, C., Corrêa, I. R., Kindermann, M., Beaufils, F., & Johnsson...https://doi.org/10.1126/science.281.5374.269 Jing, C., & Cornish, V. W. (2011). Chemical Tags for Labeling... M. G., Hartzell, D. D., Karassina, N., Zimprich, C., Wood, M. G., Learish, R., Ohana, R. F., Urh, M.,...doi.org/10.1038/nmeth749 Strebinger, D., Frangieh, C. J., Friedrich, M. J., Faure, G., Macrae, R. K., &...amino acids to directly incorporate a fluorophore in your protein or to incorporate an alkene to be labeled... self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from Roger Tsien’s lab ... -
Troubleshooting and Optimizing a Western Blot
TypeBlog Post...at 95 °C, a common lysis temperature, so consider a longer incubation (10–20 minutes) at 70 °C, or a truly... Additionally, protein lysis should be done at 4 °C or on ice, whichever is more practical. If your lysing... truly lengthy incubation (30–60 minutes) at 37 °C, if you suspect aggregation in your prep. If your proteins...protein-based blockers degrade fairly quickly, even at 4 °C, so when in doubt, make up a fresh batch. Antibodies...and time. Though the most common conditions are 4 °C overnight or room temperature for 1–2 hours, there...sample loaded Incubate primary antibody at 4 °C overnight Incomplete washing Ensuring wash is...under-transferring. Membrane pore size Membranes come in different pore sizes for different proteins:... -
Hot Plasmids and Viral Preps - March 2021
TypeBlog Post...interactions New auxin inducible degron system for C. elegans New CRISPR plasmids New items from the viral...tool-kit for the auxin inducible degron (AID) system in C. elegans By Alyssa Cecchetelli The auxin inducible... degron (AID) system has been extensively used in C. elegans since 2015 to conditionally degrade proteins...length can and should be varied as it can have important implications for the fusion protein effectivity...upon these original tools that allows for both spatiotemporal protein degradation and quantification of this...et al., 2021. The AID system relies on a transport inhibitor response 1 (TIR1) expressed under a ...a desired promoter with a specific spatiotemporal expression pattern and an auxin inducible degron (AID... -
An Integrin Antibody Toolkit from IPI
TypeBlog Post...conformations: (A) bent-closed, (B) extended-closed, and (C) extended-open. When a ligand binds, it typically ... with much lower affinity than their open states (C). Figure courtesy of IPI. IPI anti-integrin toolset...and resources References Hao, Y., Yan, J., Fraser, C., Jiang, A., Anuganti, M., Zhang, R., Lloyd, K., Jardine...Jaumouillé, V., Hao, Y., Coppola, J., Yan, J., Waterman, C. M., Springer, T. A., & Ha, T. (2022). Single-molecule...in competition with other similar integrins, as reported by IPI and the Springer lab (Hao et al., 2024)...In this study, we, along with the Springer lab, reported the binding specificity, kinetics, and affinity...belief that αVβ3 would be the most functionally important integrin on these cells. What’s next IPI is working... -
Five Popular Model Organisms, Part 2
TypeBlog Post.../000504294 Wang, T., Guan, C., Guo, J., Liu, B., Wu, Y., Xie, Z., Zhang, C., & Xing, X.-H. (2018). Pooled...doi.org/10.13918/j.issn.2095-8137.2016.4.237 McCusker, C., & Gardiner, D. M. (2011). The Axolotl Model for ...elife.50651 Vieira, W. A., Wells, K. M., & McCusker, C. D. (2019). Advancements to the Axolotl Model for ... areas of microbial research like metabolism. Transport, biofilms, and much more. Because of it’s BSL-...designed for use in Arabidopsis. There are also important tips for plant transformations and the use of ... -
TALEN Plasmids and Kits
TypeCollection...containing unique shorter N- and C-terminal domains (N153AA, C47AA). The reporter vector pGL4-SSA can be used...GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation at rates much higher...pCS2 expression vector resulting in shorter N- and C-terminal tal protein segments (136AA and 63AA, respectfully...promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which were initially...wild-type TAL amino acids after the repeat domain, and C-terminal SV40 NLS and HA tags. Plasmid 47389 also ... of the minimal activation domain of VP16) at the C terminus. 47389 pcDNA3.1-GoldenGate-VP64 Golden Gate...expression, and encode one of three 0.5 TALE repeats (C, T, and G) and the full length human LSD1 at the carboxy-terminus... -
RNA Extraction Without A Kit
TypeBlog Post...store them in a -80°C freezer to prevent RNA degradation. They will degrade in a -20°C freezer. RNA extraction...DEPC. Alternatively, glassware can be baked at 180°C for at least 4 hours. If your final RNA sample(s...extractions- if you need really clean RNA, it’s important to make sure that when extracting, to only take... -
Plasmids 101: Golden Gate Cloning
TypeBlog Post...cloning method with high throughput capability. Engler C, Kandzia R, Marillonnet S. PLoS One 2008;3(11):e3647..., Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic...2011 Apr 14. PubMed. Golden Gate cloning. Engler C, Marillonnet S. Methods Mol Biol. 2014;1116:119-31...like Gateway cloning or Gibson assembly. Another important consideration is the design of flanking overhangs... -
Split-BioID: An Improved Method for Studying Protein-Protein Interactions
TypeBlog Post...fragments: N-terminal BirA* (N-BirA*) and C-terminal BiraA* (C-BirA*). These two fragments are fused to...also which fragment of BirA*, either the N- or the C-terminus, the bait proteins were tagged with. It’s...interacting proteins. No spatiotemporal control. Many PPI detection methods lack spatiotemporal control or an “... lysate fractionation. Important considerations for Split-BioID It’s important to remember that with Split-BioID...this limitation by creating Split-BioID, a spatiotemporally controllable version of the proximity-dependent...The Split-BioID method Enter Split-BioID, a spatiotemporally controllable version of the BioID protocol... other PPI methods, including BioID, is its spatiotemporal controlled labeling of interacting proteins... -
The 10 Most Distributed Plasmid Technologies in Addgene's First 10 Years
TypeBlog Post...requested! Fire Lab C. Elegans Kit - Our first popular "kit," Andrew Fire's set of vectors for C. elegans research...added to the repository, including beta-catenin reporter M50 Super 8x TOPFlash, scramble shRNA for use ... -
Technical Design of a Western Blot
TypeBlog Post...length of your assay. The most common options are 4 °C overnight or 1–2 hours at room temperature (RT). Most...to incubate their primary antibody overnight at 4 °C and their secondary antibody for 1–2 hrs at room temperature...the DIY method. As some proteins aggregate at 95 °C, you may want to check for any available data on the...expensive, reduce protocol time, can be stored at 4 °C, and are very consistent gel-to-gel. Ladder Whatever...stored at your bench during the procedure and at 4 °C when you’re not running a western. They are not very...will noticeably degrade after several months at 4 °C. Pro tip! If you get a speckled image, your protein-based...variety of pore sizes. If your protein of interest is small, you may want to consider a smaller pore size (... -
Educational Planarian Tools for Teaching Developmental Biology Techniques
TypeBlog Post...Williams, Eric J. Ross, Sofia M. C. Robb, Sarah A. Elliott, Kimberly C. Tu, Alejandro Sánchez Alvarado,...discovered and characterized in an unrelated worm (C. elegans) [2]. Delivering dsRNA matching a specific...Hybridization (WISH) WISH is a technique that detects the temporal and spatial localization of mRNA transcripts in... -
CRISPR Plasmids - Tagging
TypeCollection... N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous...CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous proteins. The PITCh system ...CRISPR targeting vectors to insert genetic tags in the C. elegans genome. The SapTrap reaction produces a single...genome modification. This system can be used to create C- and N-terminal epitope tags. The plasmids in the ...terminal tagging in Drosophila cells 3.3 MB Seydoux C. elegans Tagging System Geraldine Seydoux's lab has developed... -
CRISPR 101: Targeting Non-Coding RNAs with CRISPR/Cas9
TypeBlog Post...still unexpectedly affect nearby genes (Figure 1A-C). Find CRISPR plasmids at Addgene! Knock-in: Introducing...site (TSS) deletion. (B) Mutations of splice sites. (C) Removal of an exon or a large genomic fragment. (... doi:10.1080/15476286.2014.996067 Basak J, Nithin C. Targeting Non-Coding RNAs in Plants with the CRISPR-Cas...experiments are important for visualizing ncRNA localization and function, but directly incorporating very long...transcribed but do not encode proteins. They play important roles in many cellular and regulatory processes...complex and not yet fully understood, so it is important to carefully select the target locations of knock-in...nuclease-dead Cas9 protein (dCas9) and a sgRNA to temporarily block the transcription machinery of a target... -
Viral Vectors 101: Voltage Indicators
TypeBlog Post... References and Resources References Beck C, Zhang D, Gong Y. Enhanced genetically encoded voltage...: 10.1016/j.cobme.2019.10.010. Bando, Y., Grimm, C., Cornejo, V.H. et al. Genetic voltage indicators.... 71 (2019). doi:10.1186/s12915-019-0682-0. Beck, C., Gong, Y. A high-speed, bright, red fluorescent voltage...sensors are better classified by their fluorescent reporter and the mechanism of their voltage sensing component...rhodopsin proteins were initially evolved for ion transport, not fluorescence, they are not nearly as bright...for penetrating deeper tissues depths (1 mm), important for certain applications such as in vivo tissue...rhodopsin Ace2N and mScarlet. Ace2N quenches a proportion of mScarlet's emission via FRET. Image from ... -
Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus
TypeBlog Post...doi.org/10.1038/mt.2009.280 Hirsch ML, Li C, Bellon I, Yin C, Chavala S, Pryadkina M, Richard I, Samulski....2010.205 Trapani I, Colella P, Sommella A, Iodice C, Cesi G, Simone S, Marrocco E, Rossi S, Giunti M, ...Trapani I, Toriello E, de Simone S, Colella P, Iodice C, Polishchuk EV, Sommella A, Colecchi L, Rossi S, Simonelli...1964 . https://doi.org/10.1172/jci34316 Bak RO, Porteus MH (2017) CRISPR-Mediated Integration of Large ...Large Gene Cassettes Using AAV Donor Vectors. Cell Reports 20:750–756 . https://doi.org/10.1016/j.celrep.2017.06.064...