Skip to main content
Addgene
Showing: 101 - 120 of 1022 results
  1. Synthetic Biology - Cloning and Genomic Tools

    Type
    Collection
    ...Genomic Tools for library construction, genomic modification, and cloning systems. Jump to Table: Cloning... or sort by the table headings. Click on the publication link to view all plasmids available from the ...Plasmid Description Gene/Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table ... or sort by the table headings. Click on the publication link to view all other plasmids from that article...Description Vector Type Selectable Marker PI Publication Back to Top Do you have suggestions for other...
  2. Antibodies

    Type
    Collection
    ...expressed from plasmids. These antibodies undergo application-specific validation and consistent quality control...and provide experimental data for recommended applications. Addgene values transparency and accessibility...Additionally, we have developed a variety of educational resources to help you choose and use antibodies...antibodies developed and validated for many research applications. Browse Antibodies Production Interested in ... storage techniques, and explain common applications. View Guide Need Some Help? Browse some of our...
  3. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...binding. Editors carrying the delta-984-1090 ADAR2 truncation retain RNA editing capabilities but are small...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...
  4. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...
  5. AAV Molecular Tools

    Type
    Collection
    ... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  6. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID...Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...
  7. Microbiology Resources

    Type
    Collection
    ...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...
  8. AAV Packaged on Request

    Type
    Collection
    ...implementation letter DNA amplification Viral vector production Density centrifugation purification Addgene’s comprehensive...preps, which includes MTA facilitation, DNA amplification, and high-quality quality control measures such...order ships. Shipping time will depend on your location. Share Your Results Once you start getting results...high-quality viral vector preps at Addgene, including purification, titration, and quality control measures. We...
  9. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...
  10. CRISPR References and Information

    Type
    Collection
    ...computational pipeline that enables accurate quantification and visualization of CRISPR-Cas9 outcomes, ...off-target sites. This algorithm allows for the quantification of both non-homologous end joining (NHEJ) and...number of potential off-targets, target's genomic location, and genome annotation. Available genomes are ...sequence, which can be an accession number, genomic location, pasted nucleotide sequence, or a sequence text...-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system...
  11. Rett Syndrome

    Type
    Collection
    ... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...
  12. Genetic Code Expansion

    Type
    Collection
    ...generally introduced in the media. A new codon to be allocated to the new amino acid. Because there are no free...single plasmid, with multiple copies of the tRNA. Applications By making small changes in selected amino acids...tRNA. And the orthogonal tRNA has to bind to an unallocated codon. Therefore many controls must be used to...code expansion without buildup of prematurely truncated protein. Ryan Mehl 197656 BL21(DE3) ΔserC serC...gene replaced by tRNA variant inactivated by the truncation of the anticodon loop). Expresses archaeal MjTyrRS...genes replaced by tRNA variant inactivated by the truncation of the anticodon loop). Expresses archaeal MjTyrRS...
  13. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...
  14. Retrograde AAV viral preps

    Type
    Collection
    ...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  15. Cancer Research Plasmids and Resources

    Type
    Collection
    ...defined by their location, their pathway dependencies are extremely important for classification and treatment...network for transitioning between anabolic and catabolic states. Ras Ras is a GTPase that is essential ... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma...
  16. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication Plant ID Plasmid Gene...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Gene/Insert PI Publication Do you have suggestions for other plasmids that should be added to this list?...
  17. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSBs) at a specific location based on a co-expressed gRNA-defined target sequence... changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...
  18. Fluorescent Protein Guide

    Type
    Collection
    ...Use this guide to learn about the applications of fluorescent proteins and to find the plasmids that ... Use this guide to learn more about the many applications of fluorescent proteins (FPs) and to find the...scientists. Browse Fluorescent Protein Plasmids by Category Empty Backbones Understand the localization and...Database hosted at the University of Arizona Zeiss Education in Microscopy and Digital Imaging Olympus Fluorescent...
  19. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ... Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...
  20. Institute for Protein Innovation

    Type
    Collection
    ...Antibody Description Isotype Reactivity Recommended Applications Integrin Antibodies Integrins are a family of...Antibody Description Isotype Reactivity Recommended Applications Browse Epitope Tag Antibodies IPI has developed...Antibody Collection page to browse Addgene’s full catalog of antibodies that target epitope tags and other...Antibody Description Isotype Reactivity Recommended Applications Browse Antibody Plasmids The following plasmids...
Showing: 101 - 120 of 1022 results