We narrowed to 130 results for: tac promoter
-
TypeBlog Post...enough to prevent confluency but high enough to promote cell growth. Overgrown cultures stimulate quiescence...mix Even before the lentiviral envelope protein attaches to cell surface receptors, other important binding...
-
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...localization sequence) and expressing it from a CAGGs promoter. However FLPe is still less efficient than Cre... the Saccharomyces Cerevisiae 2 Micron Plasmid Attaches Covalently to DNA via a Phosphotyrosyl Linkage... -
10 Steps to a Perfect Science Talk
TypeBlog Post...non-interview setting. There are many resources on self-promotion (how hard it is for some people, especially women...Describe how you pushed to a solution or overcame obstacles. Take time to consider the order of your narrative... -
PiggyBac-ing Through the Genome Editing Field
TypeBlog Post...integration at regions of open chromatin, especially at promoter or exonic regions. If the cell’s chromatin structure...piggyBac™, the cargo is inserted into the genome fully intact, while, with a standard DNA plasmid transfection...with any integrated transgene). To overcome this obstacle, a positive selection cassette can be incorporated...use of negative selection largely overcomes this obstacle. Furthermore, we have found that transfecting ... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment sites. The levels of the...integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed information about... -
Optogenetics AAV Preps
TypeCollection...non-opsin) Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a...AAV5 AAV8 AAV9 AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2... 8 Edward Boyden 105669 pAAV-CKIIa-stGtACR2-FusionRed CaMKII GtACR2 (soma-targeted) FusionRed Constitutive...* Ofer Yizhar 105677 pAAV_hSyn1-SIO-stGtACR2-FusionRed Syn GtACR2 (soma-targeted) FusionRed Cre dependent...* Ofer Yizhar 105678 pAAV_hSyn1-SIO-stGtACR1-FusionRed Syn GtACR1 (soma-targeted) FusionRed Cre dependent...Yizhar 109048 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST CAG eGtACR1 (soma-targeted) mRuby3 Cre dependent 9 ... -
CRISPR-mediated Plant Base Editors
TypeBlog Post...RNA (protospacer+scaffold) in a pol-III (OsU3) promoter driven expression system. We use a single polycistronic...Ag-biotechnologist in the National Rice Research Institute, Cuttack, Odisha, India. Currently Kutubuddin is a Fulbright... -
Transferable Skills Guide: Conflict Resolution
TypeBlog Post...When you go on interviews or are looking for a promotion, have some solid examples of times when you have...the past, or how completely different teams are tackling comparable conflicts. Is this level of domain ... -
Structural Genomics Consortium Plasmids
TypeCollection... KanR 26098 pCW-LIC EF460848 No tag, double ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...activates hypoxia inducing factor (HIF-1), which promotes the production of VEGF to increase angiogenesis...bolster and modulate our immune defenses to better attack cancer. Combing our knowledge with our bodies’ ...created by the cancer cells to shield themselves from attack. It is a region of incessant chemical activity,...that suppress APCs. T cells that would normally attack the cancer cells are also suppressed by chemical...microenvironment TGFβ, IL-10, can also help the immune system attack tumors. Attempts have been made to use whole cell...collaborative therapies must be explored. When attacking cancer, multiple immunotherapy targets can be ... -
CRISPR Plasmids - gRNAs
TypeCollection... or repression experiments use targets within promoters. Do you have gRNAs you'd like to add to the Addgene...the publication or plasmid information page, or contact the depositing PI for more information on the experimental... -
How to Design Your gRNA for CRISPR Genome Editing
TypeBlog Post...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not...clonal heterogeneity may represent a more serious obstacle to the generation of truly isogenic cell lines... -
Antibodies 101: Designing Your First Flow Panel
TypeBlog Post...spectrum. When photons are absorbed by matter, they promote electrons within atoms to a higher energy state... analysis, you'll need to use fluorophores that attach to the target. When you design a flow experiment...cells with fluorophore-conjugated antibodies that attach to a specific target. By using a mix of different... -
p53 Pathway
TypeCollection... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...early ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann ... -
CRISPR Guide
TypeCollection...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation... -
Retrograde AAV viral preps
TypeCollection...Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP...pAAV-CKIIa-stGtACR2-FusionRed CamKII Inhibitor Optogenetics Ofer Yizhar 105677 pAAV_hSyn1-SIO-stGtACR2-FusionRed... -
Deisseroth INTRSECT Collection
TypeCollection.... 2016. Serotonin engages an anxiety and fear-promoting circuit in the extended amygdala. Nature 537(7618... L, Lin JK, Wang M, Zhou L, Xu XH, Sun YG. 2019. Tac1-Expressing Neurons in the Periaqueductal Gray Facilitate...Facilitate the Itch-Scratching Cycle via Article Tac1-Expressing Neurons in the Periaqueductal Gray Facilitate... -
Sequencing Primers
TypeGuide...terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG (Waugh lab) Tac promoter, forward primer tdTomato-Fwd...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer... -
Trimmer Lab NeuroMab Collection
TypeCollection... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal/leader...CASPR2 Human Mouse IgG2a 177447 Anti-Contactin/F3 [K73/20R] Contactin/F3 Rat Mouse IgG2a 177448 Anti-SK2... -
Immunology Research Plasmids and Resources
TypeCollection...CXCL11 chemokine (C-X-C motif) ligand 11 H174, I-TAC, IP-9, IP9, MGC102770, SCYB11, SCYB9B, b-R1 CXCL12... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...STC-2, STCRP TAC1 tachykinin, precursor 1 Hs.2563, NK2, NKNA, NPK, TAC2 TACR1 tachykinin receptor 1 NK1R... cells such as macrophages and neutrophils that attack invading pathogens. Innate immune cells also process... to recognize a specific antigen, it finds and attacks pathogens or infected cells expressing that antigen...