We narrowed to 265 results for: his-tag
-
TypeBlog Post...column due to their N-terminal His14-bdNEDD8 tag. After several washes, this tag can be cleaved by the bdNEDP1...sacrifice and precludes genetic engineering of a tag or fusion with a reporter enzyme. For multicolor ...and decreases the distance between a fluorescent tag and the target antigen to about 2 nm, which can lead...antibody can be “labeled” by incubating it with a tagged nanobody. After this pre-incubation step, the primary...Label the Nanobodies: Purified nanobodies are then tagged with a fluorescent dye or HRP via maleimide-labeling...Control Protein Activity Learn more about protein tags Read about E. coli strains for protein expression... Structural Comparison Functional Comparison Advantages of Nanobodies How to Use the Nanobody Toolbox...
-
Hot Plasmids - March 2020 - base editors, GEVI, MoClo, and optogenetics
TypeBlog Post...as well as cell lineage studies. Eisenhoffer and his colleagues evaluated CreLite for cell tracing using... encoded voltage indicator Article contributed by Shreya Vedantam Genetically encoded voltage indicators...GEVIs) are proteins that detect and output the voltage changes in neural activity when paired with appropriate...appropriate fluorescent optics. Existing red fluorescent voltage indicators, however, fall short compared to GFP-based...containing a red-shifted Ace-mScarlet, a fusion of a voltage-sensitive inhibitory rhodopsin (Ace2N) with the...amino acid linker between them. The Ace-mScarlet voltage indicator works like many FRET-opsin GEVIs. With...Figure 2: Ace-mScarlet is a fusion between the voltage-sensitive inhibitory rhodopsin Ace2N and mScarlet... -
CRISPR Activators: A Comparison Between dCas9-VP64, SAM, SunTag, VPR, and More!
TypeBlog Post...combines components of SAM and SunTag activators, fusing the epitope tag of SunTag with the P65-HSF activation..., Qi LS, Weissman JS, Vale RD (2014) A Protein-Tagging System for Signal Amplification in Gene Expression...popular activation methods (VPR and SunTag) (Chavez et al., 2016). SunTag Description Rather than using a ...activation levels are similar to that of SunTag. An advantage to this method compared to other notable...-engineer components of Cas systems themselves. SunTag, SAM, and VPR have all shown significant improvements...a single copy of VP64 per each dCas9, SunTag uses a repeating peptide array to fused with multiple copies...to be recruited per targeted gene. Performance SunTag performs better than first generation activators... -
Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System
TypeBlog Post...bacteria interact with each other and plant surfaces. His system of choice is the Arabidopsis thaliana - Pantoea...modeling, directed evolution, site-saturation mutagenesis, and medium-throughput screening, she increased...serotonin receptor to study how single nucleotide polymorphisms present in the human population can affect drug... -
Using CRISPR/Cas9 to Edit Disease Out of the Genome
TypeBlog Post...diseases, Alzhiemer’s disease (AD). Troy Rohn and his lab are researching a way to treat AD using CRISPR...of the cystic fibrosis report. “This is a big advantage over induced pluripotent stem cells, which need... -
Kiran Musunuru on the Newest TALEN Genome-Editing System
TypeBlog Post...the kit now makes possible, and how it compares to his CRISPR/Cas9 system. Addgene: For people unfamiliar...together, there are occasional errors. That can be advantageous if you are trying to knock out a gene. One can...modeling in stem cells. Addgene: Tell me about the history. How had investigators done this kind of work before... -
Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies
TypeBlog Post...our guest blogger Jon Chow. Jon Chow is finishing his immunology PhD at Harvard University. He has had ...transgene ends up (1): Random insertion has the advantage that you can get varying expression levels of ...derivatives suppress TH17 cell differentiation by antagonizing RORγt activity. Nature. 472, 486–90 (2011). ... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Endogenous Gene Tagging in Human Cells on the Addgene Blog. Plasmids for Endogenous Gene Tagging in Human Cells...with endogenously-tagged cellular structures. Addgene ID Plasmid Allen Institute ID Tag Protein Structure...has deposited plasmids to generate fluorescently tagged proteins of key cellular structures in human cell...You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide Subcellular Localization...collection (Link opens in a new window) of fluorescently tagged, human, induced pluripotent stem cell (hiPSC) lines...researchers will be able to generate fluorescently tagged proteins of key cellular structures in human cell...TTN-mEGFP AICSDP-45 mEGFP Titin Sarcomeres (M-line tag) 114413 MYL7-mEGFP AICSDP-46 mEGFP MLC-2a Sarcomeric... -
Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins
TypeBlog Post...binary 2in1 vectors with all possible combinations of tag orientation (NN, NC, CN, and CC). The 4 kits also...fluorescent voltage indicator Archon Article contributed by Shreya Vedantam Listen to the voltage indicator...turned to genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s...fluorescent voltage indicator. Archon1 can embed itself into the cell membrane where cell voltage can then...coordinate emotions, thoughts, and behavior. Historically, scientists study the electrical activity in...vectors (pUC57-L1L4 and pUC57-L3L2) that offer the advantage of using restriction digest cloning to introduce... -
Human Germline Editing Using CRISPR
TypeBlog Post...paper to understand what Shoukhrat Mitalipov and his colleagues have achieved, and how the field will ... the edited embryos proceeded to the blastocyst stage at similar rates to untreated controls. Ma et al...results in fewer eggs. However, the potentially staggering costs of such a treatment on top of the expense...limited their whole genome sequencing to a small percentage of edited embryos. Since the embryos produced...had few predicted off-target effects, but this advantage likely won’t transfer to all genes we’d like to...worthwhile for a given disease if it increased the percentage of disease allele-free embryos to only 60%? Unfortunately... -
No Llamas Required - Synthetic Nanobodies Against Membrane Proteins
TypeBlog Post...which attaches a Myc-tag and a His6-tag to the end of each sybody candidate. These tags are used in a final...antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the biotinylated target protein...pBXNPHM3 expression plasmids for the production of tag-free proteins for further characterization and analysis...Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies are small ...step using ribosome display because it has the advantage of starting out with a larger initial starting... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...optimized, untagged, cleavage sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, ...expression constructs contain protein coding genes, tags, truncations, and codon optimizations similar to... downstream experiments and offer flexibility in tag, cleavage, codon usage, and expression system. Mammalian...expression vector are also available. These contain no tags and are intended to be used in the production of...Resources Page! References Fukushi S, Watanabe R, Taguchi F (2008) Pseudotyped Vesicular Stomatitis Virus... -
Antibodies 101: Immunoprecipitation
TypeBlog Post...appealing, but the disadvantages must be carefully considered before using. For example, the tag may affect the... epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest on the C- or N-terminus. ...called a pull-down assay, an antibody against the tag is used to isolate the protein of interest. The wide...interfere with protein interactions of interest. Tagged proteins are typically expressed at much higher...proteins. Data obtained from experiments using a tagged protein may not be translatable to the endogenous...with downstream assays. This is particularly advantageous if the antibody used for IP is derived from ... difference. Magnetic beads are particularly advantageous because they do not require centrifugation between... -
Plasmids 101: Sequence and Ligation Independent Cloning (SLIC)
TypeBlog Post..., courtesy of Addgene depositor Stephen Elledge. His new method, named sequence- and ligation-independent...structures at the ends of fragments. The major advantage of SLIC over Gibson assembly is cost, as T4 polymerase... -
Troubleshooting Your Plasmid Cloning Experiment
TypeBlog Post...cloning of more than 10,000 DNA custom constructs. His work was acknowledged in hundreds of publications...many softwares out there than can help you at this stage and that can be used to simulate in silico cloning... -
Sequencing Primers
TypeGuide... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...(BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end...in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator... -
5 Steps to Writing Grant Proposals for Grad Students
TypeBlog Post...this if he wants data by next week!”, and “This is his job!” filled my naive mind. Moving forward from that...of current methodologies. This section sets the stage for why your funded proposal will address these ... -
Meet an Addgenie: Insights into Grad School, Career Paths, and More
TypeBlog Post...poster a few years ago at a CRISPR meeting.Read his Instagram feature here. You also don’t have to go back... what lies ahead. Thus the “Meet an Addgenie” Instagram interview series was born. Over the six months...Shannon Rinaldi in the Addgene lab! Read their Instagram profiles here (Kenkel, Rinaldi)! But leaving...Vedantam with our resident dinosaur! Read her Instagram feature here. One of our QC Scientists, Shreya...Read all of the Meet an Addgenies features on Instagram! Staying true to your values While going through... -
Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells
TypeBlog Post...developed and demonstrated by Manuel Gonçalves and his colleagues at Leiden University Medical Center are...-transformed cells yielded rates of targeted mutagenesis similar to those achieved by isogenic AdVs encoding...gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include their episomal nature and very...used, the CRISPR approach based on HDR has the advantage of being a potentially universal treatment (Stephens...CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep 4:... -
Quick Guide to Working with Drosophila Part 1: Getting Started with Flies
TypeBlog Post...our guest blogger, Jon Chow! Jon Chow is finishing his immunology PhD at Harvard University. He has had ...three larval stages where larvae molt in order to continue growing in the next larval stage. After the ...the third larval stage, Drosophila will pupate, which takes about one week from the initial deposition of...through their translucent bodies. This is the ideal stage to select for females because you can be certain...