We narrowed to 936 results for: INA
-
TypeCollection... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...
-
Cell Migration Consortium Plasmids
TypeCollection...Consortium (CMC) Plasmids You may also like... Human Kinase ORF collection Fluorescent Protein Tools CRISPR... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...gene networks. Examples Include: promoters and terminators repressors and activators logic gates Networks... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Reporters and Tags Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic... -
KLF Research Plasmids
TypeCollection...feature of the KLF family is the presence of three C-terminal Krüppel-like zinc fingers which bind to CACCC ... -
CRISPR Plasmids - RNA Editing
TypeCollection...the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates a programmable... -
Cancer Research Plasmids and Resources
TypeCollection...Research Plasmids by Pathway mTOR mTOR is a protein kinase that anchors a signaling network for transitioning... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Design Tools CRISPR Blog Posts Using catalytically inactive Cas9 (dCas9) fused to a fluorescent marker like... -
AAV Viral Preps
TypeCollection...Channelrhodopsins, Halorhodopsins, Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate... -
CRISPR Plasmids - gRNAs
TypeCollection...each plasmid for more information on how it was originally used. Here are a few questions to consider when... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...including codon optimization, deletion of the C-terminal 18-21 amino acids and a D614G change which is ... -
CRISPR Plasmids and Resources
TypeCollection...multiple systems. RNA Editing Cas13 enzymes fused to deaminases can edit bases in RNA. Other Applications Screen... -
Serotype Testing AAV
TypeCollection...which is a sample of the purified DNA from the original plasmid that was used to make the virus. For more... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...accomplished through the use of assembly standards – combinations of restriction sites which preserve a standard... -
AAV for Neuronal Tracing
TypeCollection... are naturally expressed at presynaptic nerve terminals. (4) Neurons projecting to the starter cell are... -
Nuclear Receptor Signaling Atlas (NURSA) Plasmid Guide: Nuclear Receptors
TypeCollection...Receptor Plasmid Collection You may also like... Human Kinase ORFs Genome Engineering Guide Empty-Backbone Resource... -
Retrovirus Plasmids
TypeCollection...overexpression plasmid; deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation... -
CRISPR Plasmids - Prime Edit
TypeCollection...prime editing. Created with BioRender.com. The original prime editing enzyme is named PE1 . PE1 and most... -
Promega Plasmid Collection
TypeCollection...physiological relevance. NanoBiT Assays NanoLuc Binary Technology (NanoBiT) (Link opens in a new window...