We narrowed to 929 results for: Ina
-
TypeGuide...Guide . Recombinant AAV Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated...diversity of diseases such as inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and...frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes four non-structural...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...in order to deliver genetic cargo into cells. Recombinant AAV constructs are designed by replacing the ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination deficient bacterial strains, such as NEB Stable...
-
Molecular Biology Reference
TypeGuide... codon combinations each amino acid is encoded for by multiple codons. Plasmids and Recombinant DNA Technology...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...This obstacle has been overcome by the field of recombinant DNA technology, which enables the preparation... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study DNA ...fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used ... -
Lentivirus Plasmids
TypeCollection...Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression Ramalho-Santos 24129... -
Cloning
TypeGuide...Stitching Molecular cloning or the creation of recombinant DNA is an essential process used in scientific... most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction enzyme... Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid ...101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of Gateway...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites (in this regard, not so dissimilar from...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase... -
Tetracycline Inducible Expression
TypeCollection...developed. tTA was created by fusing tetR with the C-terminal domain of VP16 (virion protein 16), an essential...appropriate. If your gene of interest should be mostly inactive, and only turned on occasionally, using tetracycline... -
Lentiviral Vector Guide
TypeGuide...regulatory genes, accessory genes, and the long-terminal repeats (LTRs) necessary for integration. Not ... a heterologous promoter (often CMV or RSV), eliminating the need for transactivation by Tat. Most third-generation...contain a deletion in the 3’ LTR to make them self-inactivating (SIN). This deletion is transferred to the 5...incompetent by using four plasmids instead of three and eliminates the requirement for Tat. Always includes deletion...deletion in the 3' LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable... -
Antibody Guide
TypeGuide...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ... -
Optogenetics Guide
TypeGuide... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,... -
Sequencing Primers
TypeGuide...T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter ...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen...Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ... -
Gamma-Retroviral Vector Guide
TypeGuide...strand of RNA contains packaging genes and the long-terminal repeats (LTRs) necessary for integration. Wildtype...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable... strains reduce the frequency of homologous recombination of unstable regions, like the LTRs found in ...engineered to stably express gag-pol and/or env , eliminating the need to deliver these genes on separate plasmids...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...that have been deposited with Addgene are self-inactivating (SIN). These plasmids have a deletion in the... -
Validated gRNA Sequences
TypeCollection... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740... -
Promoters
TypeGuide...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals... -
Cell Migration Consortium Plasmids
TypeCollection...Consortium (CMC) Plasmids You may also like... Human Kinase ORF collection Fluorescent Protein Tools CRISPR... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...gene networks. Examples Include: promoters and terminators repressors and activators logic gates Networks... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Reporters and Tags Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic... -
KLF Research Plasmids
TypeCollection...feature of the KLF family is the presence of three C-terminal Krüppel-like zinc fingers which bind to CACCC ... -
CRISPR Plasmids - RNA Editing
TypeCollection...the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates a programmable... -
Cancer Research Plasmids and Resources
TypeCollection...Research Plasmids by Pathway mTOR mTOR is a protein kinase that anchors a signaling network for transitioning... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Design Tools CRISPR Blog Posts Using catalytically inactive Cas9 (dCas9) fused to a fluorescent marker like...