We narrowed to 139 results for: yeast

...Vancouver, BC (Canada). She works in a lab that uses yeast cells to study how DNA damage promotes cancer. She...

...biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning System and Toolkit Yeast Expression...for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast Expression, CRISPR Tom Ellis 96 plasmids...Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul Young 34 plasmids...surface display of proteins of interest. Yeast Secrete and Detect Yeast Expression Sylvestre Marillonnet Plasmids...secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast Expression...transcription units in the oleaginous yeast Y. lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids...into Y. lipolytica chromosomal loci. Yeast GPCR-sensor Toolkit Yeast Expression Tom Ellis Plasmids for constructing...

...assembly of plant multigene constructs; contains yeast two-hybrid and bacterium-to-plant translocation ...

...can be used to custom repress gene expression in yeast. TALORs consist of the DNA-binding domain of a TALE...

...Created with BioRender.com. Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very...powerful recombination abilities of yeast. By simply transforming into yeast two (or more) fragments of dsDNA... cost-saver for labs working with yeast. Figure 7: Summary of yeast-mediated plasmid cloning and oligonucleotide...Golden Gate & MoClo Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources Molecular cloning...manner. To accomplish this, you can transform into yeast the fragments of DNA to be fused along with custom...

... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ...

... also called TDH3 or GAPDH TEF1 Constitutive Yeast Yeast transcription elongation factor promoter TRE ...Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive...promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage...

...to distribute SARS-CoV-2 plasmids for E. coli , yeast, and mammalian expression, and spike ...

...and have been adapted for use in mammalian cells, yeast, and Drosophila. Synchronization of secretory protein...with fewer other proteins, had fewer effects on yeast cell viability, had less of an effect on GFP diffusion...

...catalog # AB01200-02000, LB contains: 10g tryptone 5g yeast extract 10g sodium chloride 15g agar Prepare LB ...

...pair (knocked out trpS and trpT genes). Expresses yeast TrpRS/tRNA pair instead. For directed evolution ...

...a host cell or virus, such as bacteriophages or yeast. Surface display libraries are useful for epitope...screened for binding affinity to a target molecule. Yeast Display: In this system, proteins are displayed ...

...Drosophila Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus...

...an improved peroxidase reporter, APEX2, through yeast display. APEX2 has been shown to exhibit superior...

...Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...

...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...

...libraries are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...

...libraries are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...

..., non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL Other Clear Filters...