We narrowed to 138 results for: yeast
-
TypeBlog Post...Combined with Phage for Antimicrobial Purposes Use Yeast Two Hybrid Systems to Probe Protein-Protein Interactions...
-
Plasmids 101: Using Transposons in the Lab
TypeBlog Post...size and is active in vitro as well as in vivo in yeast, plant, insect, and mammalian cells, including human... -
Promoters
TypeGuide... also called TDH3 or GAPDH TEF1 Constitutive Yeast Yeast transcription elongation factor promoter TRE ...Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive...promoter from maize ubiquitin gene GDS Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage... -
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...for our community. Developments in mammalian and yeast cells using modified Cas9 proteins to regulate gene... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog Post...Vancouver, BC (Canada). She works in a lab that uses yeast cells to study how DNA damage promotes cancer. She... -
TALEN Plasmids and Kits
TypeCollection...can be used to custom repress gene expression in yeast. TALORs consist of the DNA-binding domain of a TALE... -
CRISPR Plasmids - Tagging
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
COVID-19 Resources
TypeCollection...to distribute SARS-CoV-2 plasmids for E. coli , yeast, and mammalian expression, and spike ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...and have been adapted for use in mammalian cells, yeast, and Drosophila. Synchronization of secretory protein...with fewer other proteins, had fewer effects on yeast cell viability, had less of an effect on GFP diffusion... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...catalog # AB01200-02000, LB contains: 10g tryptone 5g yeast extract 10g sodium chloride 15g agar Prepare LB ... -
Genetic Code Expansion
TypeCollection...pair (knocked out trpS and trpT genes). Expresses yeast TrpRS/tRNA pair instead. For directed evolution ... -
CRISPR History and Development for Genome Engineering
TypeCollection...Drosophila Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus... -
Sequencing Primers
TypeGuide...Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...an improved peroxidase reporter, APEX2, through yeast display. APEX2 has been shown to exhibit superior... -
Molecular Biology Reference
TypeGuide...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter... -
CRISPR Guide
TypeGuide...libraries are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739... -
CRISPR Guide
TypeCollection...libraries are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739... -
Neurodegeneration Plasmid Collection
TypeCollection..., non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL Other Clear Filters...