We narrowed to 152 results for: yeast
-
TypeGuide...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...
-
CRISPR Plasmids - RNA Targeting
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids for Genomic Visualization
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - Xenopus
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - Zebrafish
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - Parasites
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Institute for Protein Innovation
TypeCollection... platform (Link opens in a new window) based on yeast display technology (Link opens in a new window) ... -
CRISPR Plasmids - gRNAs
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Fluorescent Protein Guide: Biosensors
TypeCollection...sensor for Yeast (AT1.03 derived) Dynamic analysis of cytosolic glucose and ATP levels in yeast using optical...yAT1.03 FRET-based ATP sensor for yeast An Improved ATP FRET Sensor For Yeast Shows Heterogeneity During Nutrient...osmolarity biosensor, for expression in E. coli , yeast, or plants Intrinsically disordered protein biosensor...pH-biosensor for reporting vacuolar turnover in yeast (cytosolic and mitochondrial) Rosella: a fluorescent... vacuolar turnover of cytosol and organelles in yeast. Autophagy. 2008 Feb;4(2):205-13. Mark Prescott ... -
CRISPR Plasmids - C. elegans
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
COVID-19 Resources
TypeCollection...The collection contains: Plasmids for E. coli and Yeast expression Spike protein constructs for making VSV... Collection page. SARS-CoV-2 Pooled Libraries - Yeast surface display libraries of Spike (S) Ectodomain... -
CRISPR References and Information
TypeCollection... support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly...genomes are human (hg19 & hg38), mouse (mm10), and yeast (strain w303). Developed by Venetia Pliatsika and... -
Adenovirus Plasmids
TypeCollection...cells or microorganisms, including bacteria and yeast. Two plasmids, termed a shuttle plasmid and an adenoviral... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...and have been adapted for use in mammalian cells, yeast, and Drosophila. Synchronization of secretory protein...with fewer other proteins, had fewer effects on yeast cell viability, had less of an effect on GFP diffusion... -
CRISPR Plasmids - Drosophila
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Antibody Plasmid Collection
TypeCollection... expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits include consistency... -
CRISPR Plasmids - Prime Edit
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...catalog # AB01200-02000, LB contains: 10g tryptone 5g yeast extract 10g sodium chloride 15g agar Prepare LB ...