CRISPR Plasmids - Parasites
Type
Collection
... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ...
We narrowed to 147 results for: yeast
-
-
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...for our community. Developments in mammalian and yeast cells using modified Cas9 proteins to regulate gene... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog Post...Vancouver, BC (Canada). She works in a lab that uses yeast cells to study how DNA damage promotes cancer. She... -
Institute for Protein Innovation
TypeCollection... platform (Link opens in a new window) based on yeast display technology (Link opens in a new window) ... -
CRISPR Plasmids - gRNAs
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR Plasmids - C. elegans
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
CRISPR References and Information
TypeCollection... support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly...genomes are human (hg19 & hg38), mouse (mm10), and yeast (strain w303). Developed by Venetia Pliatsika and... -
Adenovirus Plasmids
TypeCollection...cells or microorganisms, including bacteria and yeast. Two plasmids, termed a shuttle plasmid and an adenoviral... -
CRISPR Plasmids - Drosophila
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Antibody Plasmid Collection
TypeCollection... expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits include consistency... -
Fluorescent Protein Guide: Biosensors
TypeCollection...sensor for Yeast (AT1.03 derived) Dynamic analysis of cytosolic glucose and ATP levels in yeast using optical...osmolarity biosensor, for expression in E. coli , yeast, or plants Intrinsically disordered protein biosensor...pH-biosensor for reporting vacuolar turnover in yeast (cytosolic and mitochondrial) Rosella: a fluorescent... vacuolar turnover of cytosol and organelles in yeast. Autophagy. 2008 Feb;4(2):205-13. Mark Prescott ... -
CRISPR Plasmids - Bacteria
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...and have been adapted for use in mammalian cells, yeast, and Drosophila. Synchronization of secretory protein...with fewer other proteins, had fewer effects on yeast cell viability, had less of an effect on GFP diffusion... -
CRISPR Plasmids - Mammalian Expression
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Sequencing Primers
TypeGuide...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT... -
CRISPR Plasmids - Plants
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...catalog # AB01200-02000, LB contains: 10g tryptone 5g yeast extract 10g sodium chloride 15g agar Prepare LB ... -
TALEN Plasmids and Kits
TypeCollection...can be used to custom repress gene expression in yeast. TALORs consist of the DNA-binding domain of a TALE... -
CRISPR Plasmids - Tagging
TypeCollection... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ... -
COVID-19 Resources
TypeCollection...to distribute SARS-CoV-2 plasmids for E. coli , yeast, and mammalian expression, and spike ...