Skip to main content

We narrowed to 967 results for: ARC

Showing: 141 - 160 of 967 results
  1. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ..., the most abundant type found in bacteria and archaea. While abundant in nature, Class 1 systems are ...mechanism. Created with BioRender.com. Browse, sort, or search the tables below for CRISPR Cascade-Cas3 plasmids...
  2. TALEN Engineering

    Type
    Collection
    ...assemble TAL effector repeat arrays on a single architectural framework and the DNAs produced by all three... new version of ZiFiT Targeter enables users to search their sequences of interest for potential TALEN...
  3. Chemogenetics Plasmids

    Type
    Collection
    ...sort, or search this table to find chemogenetics plasmids in our collection. For example, search for "hM4D...
  4. CRISPR Plasmids and Resources

    Type
    Collection
    ...CRISPR plasmids available at Addgene. Search by species and CRISPR function....libraries for knockout, activation, inhibition, and barcoding experiments. Browse CRISPR Plasmids by Function...
  5. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...alleles. To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with homology...see paper) Transfection none, need Cas9 plasmid Calarco 47943 pMB70 cU6 BsaI Transfection none, need Cas9...
  6. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...monoclonal antibodies validated for neuroscience research. Find plasmids encoding these R-mAbs here....NeuroMabs) extensively validated for neuroscience research applications. A substantial number of these have...deposited with Addgene for distribution to the research community. Protocols for the generation R-mAbs...validation can be found below. With these plasmids researchers will be able to easily and inexpensively generate.... Recombinant Antibodies in Basic Neuroscience Research. Curr Prot Neurosci . 94.1. PMID: 33151027 (Link...of Camelid-Derived Nanobodies for Neuroscience Research. Curr Prot Neurosci . 94.1. PMID: 33185319 (Link...
  7. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...viral entry and infection. This approach allows researchers to safely study mechanisms of infection and to...coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular viral spike protein (MERS...
  8. Synthetic Biology - Overview

    Type
    Collection
    ...Institute Synberc - Synthetic Biology Engineering Research Center The PLOS Synthetic Biology Collection -...papers on Syn Bio SEVA - Standard European Vector Architecture Open Plant - Plant SynBio resource Synthetic...
  9. Adenovirus Plasmids

    Type
    Collection
    ...disease in humans. Advantages of adenoviruses in research include their large packaging capacity (>8 kb)... adenoviral plasmid with your gene of interest? Search our database for adenoviral transfer plasmids that...
  10. Arf GTPase Family

    Type
    Collection
    ...Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... RAS Clone Collections Richard...Dacks, J. B., & Ettema, T. J. (2016). Tracing the archaeal origins of Eukaryotic Membrane-Trafficking System...
  11. Open Enzyme Collection

    Type
    Collection
    ...for expression in Escherichia coli bacteria. Researchers can use the collection as the basis of manufacturing... parts and are not functional by themselves. Researchers should clone these enzymes into an expression...
  12. TALEN Plasmids and Kits

    Type
    Collection
    ...and 63AA, respectfully). This next generation architecture has been shown to increase mutation induction...cells, (iv) an improved, truncated TALE backbone architecture as established by Miller et al. (PMID: 21179091...
  13. Bacterial Expression Systems

    Type
    Collection
    ...replicate plasmids of all types, but beyond that, researchers also use bacteria as model systems to answer ...Addgene distributes many plasmids that can help researchers plan their experiments using bacterial expression...
  14. Validated gRNA Sequences

    Type
    Collection
    ...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...
  15. Using Video to Share Your Science: We Share Science

    Type
    Blog Post
    ...based on research that has been published, but many discuss in-progress research, proposed research looking... like ResearchGate, GoogleScholar, Academia, ORCID, and MyScienceWork all help us share research. Open... Article, since the 1980s researchers have been increasingly citing research from outside of their disciplines...support researchers as they try to keep up with the growing amount of interdisciplinary research while ...their own work. Of course not all research has to be influenced by research in other disciplines. But there...video     Video abstracts about research, especially published research, have grown in popularity over ...publishers and researchers have Facebook pages, few share any details about their research itself. Pinterest...
  16. Supporting Reproducibility with a Connected ELN

    Type
    Blog Post
    ... data sources used in research; (2) connectivity to other tools used in research; and (3) connectivity...inter-operability with other research tools and infrastructure in use at research universities not only today...the record of research compiled in the ELN. Without such references the record of research is incomplete... Connectivity to other tools used in research Just as researchers need to access and reference external...used in producing research data, and without access to them, the record of research captured in the ELN...about research that can take place in Slack normally never become part of the permanent research record...for making research data available for public access, review, and query. Gates Open Research and Wellcome...
  17. Scientific Sharing in the Time of COVID-19: Databases and Resources

    Type
    Blog Post
    ...shift towards prioritizing research into this disease. A key reason this research has been able to progress...COVID-19 research? We decided to give it a try, by creating a service for COVID-19 researchers. So far,...translational impact of research Universities have also been stepping up to support COVID-19 research. The new Center...to any researcher studying COVID-19. “Open scientific sharing is important for creating research synergies...impact of research activities. By streamlining the development and accessibility of research resources...on methods for coronavirus research, sharing resources for COVID-19 research in their field including datasets...other research, scientific sharing will remain an extremely important part of the future of research. To...
  18. Gendered Innovations: Why Does Sex of the Cell Matter?

    Type
    Blog Post
    ...of biological research that are often forgotten or ignored. If we wish to conduct research that fails less...gender analysis into research. Why are sex and gender analysis important? Doing research wrong costs lives...experiments—which can lead to failed research. For example, an international research team from Norway and Australia...variable in all NIH-funded research. Janine Clayton, Director of the Office of Research on Women’s Health, emphasizes...common worry for researchers wanting to consider sex is cost. Especially in animal research, they worry about...of doing the research correctly from the get go. The future of sex and gender in research There is much...innovation and discovery. Tackling sex and gender in research Governments, universities, and, increasingly, ...
  19. Synthetic Biology - Algal

    Type
    Collection
    ...biology plasmids for use in algae. Algal Plasmids Search the table by keyword or sort by the table headings...
Showing: 141 - 160 of 967 results