We narrowed to 962 results for: Arc
-
TypeCollection..., the most abundant type found in bacteria and archaea. While abundant in nature, Class 1 systems are ...mechanism. Created with BioRender.com. Browse, sort, or search the tables below for CRISPR Cascade-Cas3 plasmids...
-
TALEN Engineering
TypeCollection...assemble TAL effector repeat arrays on a single architectural framework and the DNAs produced by all three... new version of ZiFiT Targeter enables users to search their sequences of interest for potential TALEN... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...'s Data Hub Curated technical reports from the research community demonstrating AAV performance under ...Content from Addgene and scientists across the research community on various aspects of viral vectors,... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...viral entry and infection. This approach allows researchers to safely study mechanisms of infection and to...coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular viral spike protein (MERS... -
CRISPR Plasmids and Resources
TypeCollection...CRISPR plasmids available at Addgene. Search by species and CRISPR function....libraries for knockout, activation, inhibition, and barcoding experiments. Browse CRISPR Plasmids by Function... -
CRISPR Plasmids - C. elegans
TypeCollection...alleles. To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with homology...see paper) Transfection none, need Cas9 plasmid Calarco 47943 pMB70 cU6 BsaI Transfection none, need Cas9... -
Synthetic Biology - Overview
TypeCollection...Institute Synberc - Synthetic Biology Engineering Research Center The PLOS Synthetic Biology Collection -...papers on Syn Bio SEVA - Standard European Vector Architecture Open Plant - Plant SynBio resource Synthetic... -
Adenovirus Plasmids
TypeCollection...disease in humans. Advantages of adenoviruses in research include their large packaging capacity (>8 kb)... adenoviral plasmid with your gene of interest? Search our database for adenoviral transfer plasmids that... -
Arf GTPase Family
TypeCollection...Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... RAS Clone Collections Richard...Dacks, J. B., & Ettema, T. J. (2016). Tracing the archaeal origins of Eukaryotic Membrane-Trafficking System... -
Open Enzyme Collection
TypeCollection...for expression in Escherichia coli bacteria. Researchers can use the collection as the basis of manufacturing... parts and are not functional by themselves. Researchers should clone these enzymes into an expression... -
TALEN Plasmids and Kits
TypeCollection...and 63AA, respectfully). This next generation architecture has been shown to increase mutation induction...cells, (iv) an improved, truncated TALE backbone architecture as established by Miller et al. (PMID: 21179091... -
Bacterial Expression Systems
TypeCollection...replicate plasmids of all types, but beyond that, researchers also use bacteria as model systems to answer ...Addgene distributes many plasmids that can help researchers plan their experiments using bacterial expression... -
Validated gRNA Sequences
TypeCollection...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut... -
Synthetic Biology - Browse Plasmids
TypeCollection...email [email protected] . Synthetic Biology Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Algal
TypeCollection...biology plasmids for use in algae. Algal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Bacterial
TypeCollection...plasmids for use in bacteria. Bacterial Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Fungal
TypeCollection...biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Mammalian
TypeCollection...for use in mammalian systems. Mammalian Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Plant
TypeCollection...biology plasmids for use in plants. Plant Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Worm
TypeCollection...biology plasmids for use in C. elegans. Worm Plasmids Search the table by keyword or sort by the table headings...