Skip to main content
Addgene

We narrowed to 604 results for: SHE

Showing: 141 - 160 of 604 results
  1. Brain Armamentarium

    Type
    Collection
    ...driven by SST interneuron-targeting enhancer Gordon Fishell Viviana Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato...driven by SST interneuron-targeting enhancer Gordon Fishell Viviana Gradinaru 213941-PHPeB pAAV_BiPVe3_ChR2...driven by PV+ basket cell-targeting enhancer Gordon Fishell Viviana Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato...driven by PV+ basket cell-targeting enhancer Gordon Fishell Viviana Gradinaru 213937-PHPeB pAAV_BiPVe4_ChR2...driven by chandelier cell-targeting enhancer Gordon Fishell Viviana Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato...driven by chandelier cell-targeting enhancer Gordon Fishell Viviana Gradinaru 213915-PHPeB pAAV_BiLAMP5e3_ChR2...by Lamp5 interneuron-targeting enhancer Gordon Fishell Viviana Gradinaru 213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato...
  2. Retrograde AAV viral preps

    Type
    Collection
    ...-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell 83894...pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hDlx Inhibitor DREADD Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hDlx Activator...83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control...83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2...Cre-dependent Calcium sensor Ting 83899 pAAV-mDlx-GCaMP6f-Fishell-2 mDlx GCaMP6f expression under the control of ...of the mDlx enhancer element Calcium sensor Fishell 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s...Activator DREADD Fishell 98747 pAAV-FLEX-EGFPL10a EF1a EGFPL10a, Cre-dependent Molecular Tool Heintz , ...
  3. COVID-19 Resources

    Type
    Collection
    ... Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad Institute has published information and protocols...Resource Guide . Return to top General Plasmid Tools SHERLOCK and DETECTR - Simple, portable, and inexpensive...read Addgene's Blog: Finding nucleic acids with SHERLOCK and DETECTR . Feng Zhang's lab at the Broad Institute...protocols for utilizing SHERLOCK to detect coronavirus - Enabling coronavirus detection using CRISPR-Cas13...CRISPR-Cas13: Open-access SHERLOCK research protocols and design resources (Link opens in a new window) Find Zhang...Trans Reporter (DETECTR). Mammoth Biosciences has published information and protocols for utilizing DETECTR... reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Huntington's Michael Sherman 1385 pYES2/103Q HTT Flag, GFP GAL1 Huntington's Michael Sherman 8412 pMTH PKC gamma...CMV ALS Elizabeth Fisher 26398 pF152 pcDNA3.1(+)SOD1A4V SOD1 CMV ALS Elizabeth Fisher 26399 pF153 pcDNA3.1...CMV ALS Elizabeth Fisher 26400 pF154 pcDNA3.1(+)SOD1G85R SOD1 CMV ALS Elizabeth Fisher 26401 pF155 pcDNA3.1...CMV ALS Elizabeth Fisher 26402 pF141 pAcGFP1 SOD1WT SOD1 GFP CMV ALS Elizabeth Fisher 26403 pF142 pAcGFP1...CMV ALS Elizabeth Fisher 26404 pF143 pAcGFP1 SOD1G37R SOD1 GFP CMV ALS Elizabeth Fisher 26405 pF144 pAcGFP1...CMV ALS Elizabeth Fisher 26406 pF145 pAcGFP1 SOD1G93A SOD1 GFP CMV ALS Elizabeth Fisher 26407 pF146 pSOD1WTAcGFP1...CMV ALS Elizabeth Fisher 26408 pF147 pSOD1A4VAcGFP1 SOD1 GFP CMV ALS Elizabeth Fisher 26409 pF148 pSOD1G37RAcGFP1...
  5. Control AAV Preps

    Type
    Collection
    ...pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx...83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Fishell 99130 pAAV-mDlx-NLS-mRuby2...Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent...
  6. Rett Syndrome

    Type
    Collection
    ...Mouse line with conditional deletion of Xist Unpublished Joost Gribnau Human Cell Line Models Induced ....806delG 806delG G269Afs*20 M Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold A140V...A140V C419T A140V M Fibroblasts Unpublished (Link opens in a new window) Wendy Gold AN_BU 808delC Arg270Glufs...Arg270Glufs*19 F Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold BO_DI 806delG G269Afs...G269Afs*20 F Fibroblasts Unpublished (Link opens in a new window) Wendy Gold HO_AN G917A R306H F Fibroblasts...Fibroblasts Unpublished (Link opens in a new window) Wendy Gold For more information on generating iPSCs using...
  7. Validated gRNA Sequences

    Type
    Collection
    ...26527385 Sherwood Pal7 synthetic GGCTTAGTACTAGTACTAAGC 71484 cut S. pyogenes 26527385 Sherwood PAX6 H. ...GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA...our datatable, please download the following spreadsheet, fill out as much information as possible on ....org with the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our... resources! Download validated gRNA sequence spreadsheet...
  8. Chemogenetics AAV Preps

    Type
    Collection
    ...-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D...
  9. CRISPR Guide

    Type
    Collection
    ...platform, termed SHERLOCK, can identify target sequences using a fluorescent reporter. In SHERLOCK, a quenched... the presence of that specific target. SHERLOCK (and SHERLOCKv2) allows for greater amplification and ...bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the Feng Zhang lab , is a Cas13a-based...flow strips. Other Cas enzymes can be added to SHERLOCKv2 to detect multiple targets. For example, Cas12...Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & ...system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman, E., Younger, S. T., & Rinn...
  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    .... pyogenes Matlashewski pSPneoHHgRNAH 63557 Other/Leishmania none S. pyogenes Matlashewski pLH-spsgRNA2...52256 Plant AscI, PacI, SbfI yes, cut S. pyogenes Sheen pT7-gRNA 46759 Zebrafish BsmBI none S. pyogenes ...-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI none S. pyogenes Yang pRPR1...2xBbsI-sgRNA-HygR) 71485 Mammalian none S. pyogenes Hygro Sherwood pMpGE_En01 71534 Other/Marchantia polymorpha MpU6...
  11. TALEN Guide

    Type
    Collection
    ...CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter Overview...Halle-Wittenberg and Adam Bogdanove at Iowa State University published the nucleotide recognition code of the TAL effectors... before the end of the year. Dr. Zhang ‘s lab published a paper on TAL effectors in Nature Biotechnology...
  12. Antibody Guide

    Type
    Collection
    ...the number of signaling molecules that can be distinguished in your application. The indirect detection ...Cross-link the samples with formaldehyde or UV light. Shear the samples using sonication to break DNA up into...protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This method is suitable...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody...
  13. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...note that the following table lists both published and unpublished plasmids containing gRNA sequences designed...
  14. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...These vectors are based on the pFA6a-link plasmid (Sheff et al., 2004; Lee et al., 2013), and are available...window) PMID: 17293878 (Link opens in a new window) Sheff, M. A., Thorn, K. S. (2004). Optimized cassettes...
  15. AAV Packaged on Request

    Type
    Collection
    ...often goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible...with troubleshooting and results that complement published data, capturing the insights that often go unshared...
  16. Zebrafish Plasmid Collection

    Type
    Collection
    ... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the...combinatorial and cumulative genome editing - Jay Shendure Lab Simultaneous single-cell profiling of lineages...
Showing: 141 - 160 of 604 results