We narrowed to 172 results for: TOX;

1. The Fluorescent Vegetables in Aptamer Soup

   Type

   Blog Post

   ...imidazolinone (DFHBI). DFHBI is membrane permeable and non toxic to cells. Because it rapidly photobleaches, DFHBI...

2. Transferable Skills Guide: Conflict Resolution

   Type

   Blog Post

   ...for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked. ...

3. Plasmids 101: Expressing shRNAs for RNA Interference

   Type

   Blog Post

   ...specificity, so in some cases they can lead to toxicity and off target effects. More recently, shRNA plasmids...

4. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

   Type

   Blog Post

   ...Cas9 is no longer necessary. However, Cas9 can be toxic if continuously expressed (Fu et al., 2013). Using...

5. Hot Plasmids: Summer 2024

   Type

   Blog Post

   ...methyltransferase for epigenetic silencing, which can be toxic, CHARM uses a cofactor fused to a histone tail to...

6. CRISPR 101: Homology Directed Repair

   Type

   Blog Post

   ... can be used, however, these are generally more toxic to cells than their plasmid counterparts. Another...

7. Antibodies 101: Introduction to Gating in Flow Cytometry

   Type

   Blog Post

   ...-mouse CD8b-PerCP-Cy5.5), which is present on cytotoxic T killer cells but not dendritic cells. Using ...

8. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

   Type

   Protocol

   ...reproducibility in science. Safety Warnings Sodium azide is toxic. When handling, use proper personal protective equipment...

9. Is this the right place for me? 8 tactics for choosing a lab

   Type

   Blog Post

   ... choose wisely. From the Tenure She Wrote blog, Toxic Academic Mentors.  What is workplace bullying? ...

10. Important Considerations When Using AAVs

    Type

    Blog Post

    ...tracing methods used viruses that were potentially toxic and would result in cell death. With several new...

11. Quick Guide to All Things Lentivirus

    Type

    Blog Post

    ...constitutively or inducibly. If your gene of interest is toxic or needs to be expressed a certain point in the ...

12. Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

    Type

    Blog Post

    ... of Red proteins is critical for minimizing the toxic effects of Gam expression and to limit spontaneous...

13. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type

    Blog Post

    ...organisms with functional APT will convert 2-FA to cytotoxic nucleotides, resulting in death. In the presence...

14. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type

    Blog Post

    ...removal from the infected culture. MRAs are non-toxic, effective in the removal of most of the mycoplasma...

15. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type

    Blog Post

    ...repair templates. They found that Cas9 RNPs could be toxic at high concentrations, and editing efficiency improved...

16. Sequencing Options for CRISPR Genotyping

    Type

    Blog Post

    ...multiplexing Requires delivery of dsODN (potentially toxic) Digenome Seq 0.1% Cell-free (in vitro) Works ...

17. AAV Production in HEK293 Cells

    Type

    Protocol

    ...post transfection. Changing the media can reduce toxicity associated with PEI and allow for the addition...

18. Validated gRNA Sequences

    Type

    Collection

    ...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...

19. Custom CRISPR Screens & the Green Listed Software

    Type

    Blog Post

    ...phenotype (e.g. survival of a cancer cell as a cytotoxic drug is added), and decide which genes you’d like...

20. Special Delivery: Fluorophore Targeting for FRET Studies

    Type

    Blog Post

    ...was originally developed to treat heavy metal intoxication in chemical warfare [Vilensky & Redman, 2003...