We narrowed to 263 results for: his-tag

...which attaches a Myc-tag and a His6-tag to the end of each sybody candidate. These tags are used in a final...antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the biotinylated target protein...pBXNPHM3 expression plasmids for the production of tag-free proteins for further characterization and analysis...Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies are small ...step using ribosome display because it has the advantage of starting out with a larger initial starting...

...optimized, untagged, cleavage sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, ...expression constructs contain protein coding genes, tags, truncations, and codon optimizations similar to... downstream experiments and offer flexibility in tag, cleavage, codon usage, and expression system. Mammalian...expression vector are also available. These contain no tags and are intended to be used in the production of...Resources Page! References Fukushi S, Watanabe R, Taguchi F (2008) Pseudotyped Vesicular Stomatitis Virus...

...appealing, but the disadvantages must be carefully considered before using. For example, the tag may affect the... epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest on the C- or N-terminus. ...called a pull-down assay, an antibody against the tag is used to isolate the protein of interest. The wide...interfere with protein interactions of interest. Tagged proteins are typically expressed at much higher...proteins. Data obtained from experiments using a tagged protein may not be translatable to the endogenous...with downstream assays. This is particularly advantageous if the antibody used for IP is derived from ... difference. Magnetic beads are particularly advantageous because they do not require centrifugation between...

..., courtesy of Addgene depositor Stephen Elledge. His new method, named sequence- and ligation-independent...structures at the ends of fragments. The major advantage of SLIC over Gibson assembly is cost, as T4 polymerase...

...cloning of more than 10,000 DNA custom constructs. His work was acknowledged in hundreds of publications...many softwares out there than can help you at this stage and that can be used to simulate in silico cloning...

...TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity...affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...

...this if he wants data by next week!”, and “This is his job!” filled my naive mind. Moving forward from that...of current methodologies. This section sets the stage for why your funded proposal will address these ...

...poster a few years ago at a CRISPR meeting.Read his Instagram feature here. You also don’t have to go back... what lies ahead. Thus the “Meet an Addgenie” Instagram interview series was born. Over the six months...Shannon Rinaldi in the Addgene lab! Read their Instagram profiles here (Kenkel, Rinaldi)! But leaving...Vedantam with our resident dinosaur! Read her Instagram feature here. One of our QC Scientists, Shreya...Read all of the Meet an Addgenies features on Instagram! Staying true to your values While going through...

...our guest blogger, Jon Chow! Jon Chow is finishing his immunology PhD at Harvard University. He has had ...three larval stages where larvae molt in order to continue growing in the next larval stage. After the ...the third larval stage, Drosophila will pupate, which takes about one week from the initial deposition of...through their translucent bodies. This is the ideal stage to select for females because you can be certain...

...developed and demonstrated by Manuel Gonçalves and his colleagues at Leiden University Medical Center are...-transformed cells yielded rates of targeted mutagenesis similar to those achieved by isogenic AdVs encoding...gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include their episomal nature and very...used, the CRISPR approach based on HDR has the advantage of being a potentially universal treatment (Stephens...CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep 4:...

... who later shared a Nobel Prize in Chemistry for his work. Since then PCR has become a standard and essential...generating mutated sequences for site-directed mutagenesis.  Quantitative polymerase chain reaction, qPCR...interest  Molecular Cloning Site-directed mutagenesis Molecular Diagnostics qPCR Quantify starting... PCR  Plasmids 101: Colony PCR Site Directed Mutagenesis by PCR Resources on Addgene.org Protocol: Polymerase...

...antibodies against the same target; tagged protein strategies that express a tagged version of the antigen and ...compare staining of the antibody to that of the anti-tag antibody; and immunoprecipitation-mass spectrometry...be variations within an application. Take immunohistochemistry (IHC), for instance. While an antibody may...

...al., 2023). Our thanks to Rodolphe Barrangou for his authorial contributions to, and support for, this... shipped out each year.     Figure 3: Percentage of requests per year for CRISPR plasmids categorized...

...generate one molecule of GFP-tagged LC3 for every one molecule of RFP-tagged LC3∆G. Like the unmodified ...of autophagic substrates inside the lysosome. Historically, methods for studying autophagy focused on counting...

...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system — co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...Plasmids: Double-Strand Break (Cut) , Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification...

...frequent bouts with Impostor Syndrome, Joe has found his people through meetings and social media. Joe is ...conference hashtag I had, however, started a Twitter account, and was following the meeting hashtag. I noticed...Favorable conditions - Expansion of networks The last stage is Exponential Growth, named after the growth phase..., and the Society for Advancement of Chicanos/Hispanics and Native Americans in Science’s (SACNAS) annual... career scientists, students, and those from historically underrepresented groups. Through such mentoring...

... vivo. Some researchers have used fluorescently tagged DNA-binding proteins to label certain loci, but...Kits Find Empty Backbones with Fluorescent Protein Tags ...the 4D nucleome. Visualizing specific loci has historically been difficult, as techniques like fluorescent...this rainbow of colors, Ma et al. performed sophisticated tracking of multiple chromosomal loci in live...

...lentiviral vectors to stably or inducibly express tagged iPAK4 from different promoters, specific time points...plasmids here! Lin D., Li X., et al. (2023). Time-tagged ticker tapes for intracellular recordings. Nature...externally-timed bands of color with HaloTag-iPAK4 by applying different HaloTag dyes and showed they could record...proximity labeling and TransitID Tracking cellular history with protein ticker tape Teaching an old antibody....1101/2023.02.07.527548.    Tracking cellular history with protein ticker tape By Brian O’Neill The Cohen...created a system for recording the transcriptional history of a cell. Lin et al. generated a fusion protein...ticker tape images could recover transcriptional histories, accurate to within 40 minutes. Figure ...

...Petri dish (VWR, 11019-552) 4 MaxiPreps (Qiagen HiSpeed Max, Catalog #12663) Tips (1000 µL, 200 µL, 10 ...Caution Electroporation involves the use of high voltages, please use caution when activating pulse and ...down at 30 ℃ overnight. Critical Ensure at this stage that no unabsorbed media drips onto the lid. Let... Maxiprep. Purify plasmid DNA using the Qiagen HiSpeed Maxi Kit (one conical is its own Maxiprep). Critical...

...102930 pLJC5-Tmem192-3xHA 3rd Contains a lysosomal tag. See Abu-Remaileh et al. (2017) for additional variants... Thy1.1 selection. Christophe Benoist and Diane Mathis 21915 Tet-pLKO-puro 3rd Inducible expression of...