Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 658 results for: otos

Showing: 141 - 160 of 658 results

  1. Finding nucleic acids with SHERLOCK and DETECTR

    Type
    Blog Post
    ...that the protocol is not approved for clinical use at this point, they hope that the protocol serves as...et al., 2018). Now, the Zhang lab has shared a protocol for using SHERLOCK to detect SARS-CoV-2 RNA. The... Singh J, Miao X, Streithorst JA, Granados A, Sotomayor-Gonzalez A, Zorn K, Gopez A, Hsu E, Gu W, Miller...

  2. Career Insights: Technical Support Specialist

    Type
    Blog Post
    ... tries to “optimize” a particular standard lab protocol. For example, someone may attempt super quick ...quick incubation times in a Western Blot protocol and then blame the antibody when no signals are obtained...so many things which can go wrong in a lengthy protocol. And customers may tell all sorts of details about...reviewing customer data sets, troubleshooting protocols, analyzing information, and solving customer problems...

  3. Validated gRNA Sequences

    Type
    Collection
    ...24954249 Yamamoto HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto IL1RN H...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table ...see article 69537 activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut ...TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut...TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate...

  4. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...GFP can exist in a protonated and a deprotonated state (Tsien, 1998). The deprotonated state has an absorbance... and it emits light that peaks at 508 nm. The protonated state, however, does not absorb light at 488 ...

  5. Antibodies 101: Introduction to Gating in Flow Cytometry

    Type
    Blog Post
    ...FSC/SSC), the detected photons can be represented through a graph of photocurrent vs. time. The resulting...electric potential that can be applied to the photomultiplier inside the cytometer to increase the electric...-mouse CD8b-PerCP-Cy5.5), which is present on cytotoxic T killer cells but not dendritic cells. Using ...

  6. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...intensity, caused partially by fluorophore photoinstability, as well as the tendency of fluorophores to...ideal characteristics (low aggregation, high photostability, and high stability after fixation.) From the...cells in which the construct is expressed. The photostability of Brainbow-3.2 is improved due to the addition...of neural circuits, such as connections between motor neurons and the neuromuscular junction. In zebrafish...

  7. CRISPR Plasmids - Tagging

    Type
    Collection
    ... Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging System The Takashi Yamamoto lab has deposited...provided their protocol for homology arm cloning: Mendenhall & Myers FETCh-seq Protocol 134.7 KB Mendenhall...can be found in Sakuma et al., Nature Protocols, 2016 . Yamamoto Tagging Plasmids: pX330S-2-PITCh - expresses...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR...tagging techniques, as well as the plasmids and protocols needed for using them, are described below. Read...2014 The Förstemann lab has provided detailed protocols for N- or C-terminal tagging in Drosophila cells...locus in C. elegans . This system uses a 10-day protocol, generates “clean” homozygous mutants with no ...

  8. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...fiber photometry.  Figure 1: Characterization of iGluSnFR4 in mice. A) Scheme for two-photon (2P...iGluSnFR4s produces larger signal-to-noise ratios in two-photon imaging, making it ideal for video recordings of...after inserting EGFP and provide step-by-step protocols for viral generation and stable cell line creation...

  9. CRISPR References and Information

    Type
    Collection
    ...Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...2014) (Link opens in a new window) . protoSpaceJAM protoSpaceJAM is an all-around platform for CRISPR ...cloning; injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic Deletions...Resources CRISPR Software General Resources CRISPR Protocols Addgene CRISPR Resources CRISPR Plasmids Addgene's... (Link opens in a new window) A collection of protocols, materials, and publications by members of the... library amplification CRISPR pooled libraries Protocol at Addgene Church gRNA design and cloning gRNA...pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles Fly: gRNA and ssODNs...

  10. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ...or multicolor imaging. Photo-activatable iRFPs can be turned on by non-phototoxic far-red light and can...690/717 (after photoactivation) 3.2 pPAiRFP1-N1 PAiRFP2 692/719 (after photoactivation) 3.0 pPAiRFP2-N1... imaging using far red, near-infrared, and photoactivatable fluorescent proteins. Plasmid...Proteins: In Vivo Imaging Far-Red Near-Infrared Photoactivatable In vivo imaging is a powerful tool used to...imaging are derived from bacterial phytochrome photoreceptors (BphPs). Spectrally distinct fluorescent iRFP...piRFP720-N1 iSplit 690/713 5.3 pPAS-E and pK-GAFm Photoactivatable Protein Excitation/Emission Brightness Plasmids...

  11. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Gamma-protocadherin-A3 [N144/5R] Gamma-protocadherin-A3 Mouse Mouse IgG2a 222155 Gamma-protocadherin-B2 ...Mouse IgG2a 164156 Anti-Gamma-protocadherin-C3 [N174B/27R] Gamma-protocadherin-C3 Mouse Mouse IgG2a 164157... 177503 Anti-Pan-Gamma-protocadherin-Constant [N159/5R] Pan-Gamma-protocadherin-Constant Mouse IgG2a 177504...IgG2a 182105 Anti-Pan-Gamma-protocadherin-A [N144/32R] Pan-Gamma-protocadherin-A Mouse IgG2a 182106 Anti-Histone...Mouse IgG2a 190299 Anti-Gamma-protocadherin-B2 [N148/30] Gamma-protocadherin-B2 Mouse Mouse IgG2a 190300...Mouse IgG2a 199398 Anti-Gamma-protocadherin-A3 [N144/17R] Gamma-protocadherin-A3 Rat Mouse IgG2a 199399 Anti-PINK1...Pan-Gamma-protocadherin-Constant recombinant mouse monoclonal antibody. Pan-Gamma-protocadherin-Constant...

  12. 'Tis the Season to #DeckTheLab

    Type
    Blog Post
    ...fabulous photos again this year! Why #DecktheLab? Help us spread some cheer by snapping a photo of you... Festivus— you name it, we want to see it! All photos tagged with #DeckTheLab throughout the month of...

  13. DIY DNA Ladders from Penn State University

    Type
    Blog Post
    ...significantly cheaper. When using a homemade plasmid prep protocol, it cost less than $10 to make 1000 lanes worth...ladder? You can find the Tan Lab’s DNA ladder prep protocol here and the pPSU1 and the pPSU2 plasmids are ...Use the Kit-Free Alkaline Lysis Plasmid Miniprep Protocol Learn How to Analyze Your Restriction Digests ...

  14. New Podcast Segment: Hot Plasmids

    Type
    Blog Post
    ... new ways to learn about science careers, lab protocols, and, of course, plasmids. Today we’re trying ...Domain Constructs Kit Hot Plasmid 4: The Yeast Prototrophy Kit from Markus Ralser's Lab -  Use this kit ...strains.  Listen to Our Segment on The Yeast Prototrophy Kit Special thanks to our sound engineer/producer...

  15. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...Halloween festivities for years – searching our photo archives I found pictures back through 2009, though...contests were indeed occurring earlier but that the photo evidence was destroyed to protect the innocent revelers...Facebook and checkout our FB page on Friday for more photo evidence.        ...

  16. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE CamKII ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE EF1a ChRmine (high-photocurrent, red-shifted) mScarlet Cre dependent 1, 5 Karl... 6m-p2A-ChRmine-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) GCaMP6m Constitutive 8 Karl Deisseroth... pAAV-nEF-ChRmine-mScarlet nEF ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-nEF-Con/Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Cre and Flp dependent...-Coff/Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Flp dependent 8 Karl ...

  18. Genetic Code Expansion

    Type
    Collection
    ...Kensaku Sakamoto 197099 pIYN3 TyrRS M. jannaschii halogenated tyrosines Bacterial TAG Kensaku Sakamoto 197100...Kensaku Sakamoto 197101 pCDF-Az TyrRS M. jannaschii azidophenylalanine Bacterial TAG Kensaku Sakamoto 197102...you are working off of a previously established protocol, make sure to match the growth medium, ncAA concentration... pMAH2-CageCys leucyl-tRNA-synthetase E. coli photocaged cysteine Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS...91705 pSupAR-MbPylRS(DiZPK) PylRS M. barkeri photocrosslinkers DiZPK, DiZSeK, or DiZHSeC Bacterial TAG P....91706 pCMV-MbPylRS(DiZPK) PylRS M. barkeri photocrosslinkers DiZPK, DiZSeK, or DiZHSeC Mammalian TAG P.... PylT_FLAG-AbKRS-chIPYE chimeric PylRS Chimeric photo-crosslinking-lysine Mammalian TAG Simon Elsaesser...

  19. Your Top Requested Plasmid in 2016!

    Type
    Blog Post
    ...viral trasduction (see the Zhang Lab's Nature Protocols Paper for more information). V2.0 This designation...variants, as well as links to the Zhang Lab's Nature Protocols Publication describing them here. References ...engineering using the CRISPR-Cas9 system." Nature protocols 8.11 (2013): 2281-2308. PubMed PMID: 24157548....

  20. Ras Pathway

    Type
    Collection
    ...Serine/threonine kinases: A-Raf proto-oncogene B-Raf proto-oncogene Raf-1 proto-oncogene RAL RALA RALB v-ral...substrate JUN Jun proto-oncogene KSR KSR1 KSR2 Kinase suppressor of ras MDM2 MDM2 proto-oncogene MEK MAP2K1...Mitogen-activated protein kinase ETS ETS1 ETS2 ETS proto-oncogene, transcription factor EXOC EXOC1 EXOC2 ...Mitogen-activated protein kinase kinase MET MET proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated... coiled-coil containing protein kinase ROS1 ROS proto-oncogene 1, receptor tyrosine kinase RPS6KA RPS6KA1...
Showing: 141 - 160 of 658 results