Skip to main content
Addgene
Showing: 161 - 180 of 393 results

  1. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...animal, and its B cells will churn out antibodies against the injected protein. Several weeks later, blood...protein. However, each animal will make antibodies against different protein epitopes and so variability between...

  2. Which Fluorescence Microscopy Techniques is Best for Me?

    Type
    Blog Post
    ... create a thin sheet of excitation light that propagates perpendicular to an imaging objective that collects...excitation light is completely reflected, energy is propagated into the sample via an evanescent wave that only...

  3. Sequencing Primers

    Type
    Guide
    ...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 ...AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...AUG1 promoter, reverse primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator...beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse...immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer... promoter, forward primer EF-1a Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a ...

  4. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...steps and the joined modules cannot be separated again by the same cloning enzymes. MXS (MluI-XhoI-SalI...properties, they generated monoclonal antibodies against them, fused them to GFP, and compared them to popularly...In order to overcome these limitations, Takeharu Nagai and colleagues at Osaka University have developed...

  5. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...affordably in bacteria. They are compatible with both agarose and polyacrylamide gels. They are shared through...utilize CRISPR Cas9 systems to defend themselves against bacteriophage infection, but some phages fight ...

  6. Antibody Guide

    Type
    Guide
    ...which is immobilized on agarose or magnetic beads. Using centrifugation (for agarose beads) or a magnet (...developed, the antibodies are collected, tested against the antigen, packaged, and sold. This is the most...unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic... directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs...materials. There are two primary methods used, using agarose or magnetic beads, but both rely on the same general...most or all of their extracellular matrix removed. Again, the signaling molecule may be a fluorophore or ...or more conjugated primary antibodies, and wash again. Use controls to identify, or gate, cells by size...

  7. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...increase the chances of inducing an immune response against the capsids or transgenes. Sensory neurons and ... is not neutralized by pre-existing antibodies against AAV9-based vectors (and vice versa), enabling repeat...

  9. 'Tis the Season to #DeckTheLab

    Type
    Blog Post
    ...creative scientists will deliver some fabulous photos again this year! Why #DecktheLab? Help us spread some...

  11. We’re Going Viral This Week!

    Type
    Blog Post
    ... the viral service, and now we’re “going viral” again! #AddgeneGoesViral on Twitter Starting today, our...

  15. Editor's Choice, October 2016

    Type
    Blog Post
    ...was no less busy for the Addgene blog which once again had record readership with over 75,000 views. Changing...

  19. Why Do I Need an MTA Anyway?

    Type
    Blog Post
    ...the plasmid sharing space, we heard over and over again that the legal documents were one of the biggest...
Showing: 161 - 180 of 393 results