We narrowed to 263 results for: gfp

1. Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

   Type

   Blog Post

   ...Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre....

2. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

   Type

   Blog Post

   ... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...

3. Lentiviral Prep Service

   Type

   Collection

   ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ...

4. Cloning Mammalian Cells with the Agarose Method

   Type

   Blog Post

   ...select both over- and under-expressing clones. If GFP-encoding cDNA is co-transfected at a favorable ratio...

5. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

   Type

   Blog Post

   ...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple...

6. Hot Plasmids February 2024

   Type

   Blog Post

   ..., Myc and SV40 Nuclear Localization Signals, and GFP. B) Workflow to assess Cas9-PAGE editing with viral...

7. Serotype Testing AAV

   Type

   Collection

   ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

8. Validated gRNA Sequences

   Type

   Collection

   ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...

9. Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy

   Type

   Blog Post

   ...check out our article: Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection. Cellular...

10. CRISPR 101: RNA Editing with Cas13

    Type

    Blog Post

    ...which must be stabilized by monomeric superfolded GFP and averages only ~50% RNA knockdown. In initial ...

11. CRISPR 101: Targeting RNA with Cas13a (C2c2)

    Type

    Blog Post

    ... a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate cleavage...

12. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type

    Blog Post

    ...Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your Fluorescent Protein...

13. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type

    Blog Post

    ...used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed mutations,...

14. Tips for arabidopsis transformation

    Type

    Blog Post

    ...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG). There...

15. Simplify Cloning with in vivo Assembly

    Type

    Blog Post

    ...mutation can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications...

16. Antibodies 101: Immunoprecipitation

    Type

    Blog Post

    ...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...

17. The Challenges of Cell Culture

    Type

    Blog Post

    ...Mammalian Cells Learn about the Dangers of Using GFP for Protein Localization Resources on Addgene.org...

18. Avoiding the Dark Side of Fluorescent Protein Fusions with mOX FPs

    Type

    Blog Post

    ...Lindsey M. Costantini, and Erik L. Snapp. "Superfolder GFP is fluorescent in oxidizing environments when targeted...

19. Tips for Screening with Yeast Two Hybrid Systems

    Type

    Blog Post

    ...in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with a transcriptional...

20. Tips for Using FRET in Your Experiments

    Type

    Blog Post

    ...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-...