...technologies. Penn Vector Core AAV Vectors Many AAV vectors from the Penn Vector Core have been transferred to Addgene... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...and we’ll make the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information...about viral vector production at Addgene, ordering information, and more. Additional Viral Vector Resources...when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation...biosafety of viral vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from...aspects of viral vectors, including troubleshooting advice and explanations of viral vector technologies....

...never happen. Yet with transcription activator-like (TAL) effectors, scientists in several biological disciplines... and help can be found at TALeffector Resources Center (www.taleffectors.com) . Whether you work in a ...between two distinct ZF target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ...published the nucleotide recognition code of the TAL effectors, which were isolated from the plant bacterial ...that determines which single nucleotide the TAL effector will recognize: ( Figure 1B ) HD targets cytosine... in your average genome are every 500 bp. TAL effectors have some restrictions (for example, the target...determining the importance of context for each TAL effector within an array, but early studies suggest the...

... Tumor necrosis factor receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell ... PAI Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP...p14ARF Cyclin-dependent kinase inhibitor 2A p21 Cyclin-dependent kinase inhibitor 1A p48 Damage-specific DNA...plasmids for the p53 pathway. p53 is a transcription factor and tumor suppressor activated by cellular stress...Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...List References Background p53 is a transcription factor and tumor suppressor activated by cellular stresses..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity...

...EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria GAAGTTCGAGGGCGACACCC... EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria GATGCCGTTCTTCTGCTTGT... EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC...EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG... EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria GGGCGAGGAGCTGTTCACCG... EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria GGTGGTGCAGATGAACTTCA... GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA...

...upper and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to...AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell ...tet-inducible expression of transcription factors for sensory, motor, and cortical neuron differentiation....CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies Fluorescent Proteins Other Resources...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases...portion of cases can be attributed to known genetic factors such as defects in LRRK2, SNCA, PARK7, or PINK1... gene variation and lifestyle or environmental factors. For example, variations of Apolipoprotein E (APOE...

...assembling plant transformation vectors - Daniel Voytas. Transcription Factors The following collections can...plants: Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant...microRNA and siRNA vectors in Arabidopsis - James Carrington. JoinTRV , an improved vector system based on...Blog: Plant Biology CRISPR Cloning Transcription Factors RNAi Empty Backbones Fluorescent Proteins Other...Other Resources Background Addgene’s repository contains many plasmid tools that were specifically designed...plant species (e.g. maize and Arabidopsis) and vectors for easy assembly of one or more gRNA expression...for Plants includes CRISPR/Cas nucleases, base editors, gRNA backbones, and promoters for expression in...

...mutations of these regulatory elements on gene expression. Empty backbones for inserting regulatory elements before... reporter vector via Gateway cloning to test for the presence of transcriptional regulatory region in ...regions Joshua Mendell 212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription...are commonly used to investigate the effect of regulatory elements, such as promoters, enhancers and untranslated...strong constitutive promoter and can be used to monitor transfection or viral infection efficiency, to ...luciferase to assess FKBP and FRP interactions in the mTOR signaling pathway in vivo . DULIP ( DU al L uminescence-based...Optimized STARR-seq ( S elf- T ranscribing A ctive R egulatory R egion) plasmids : Genome-wide screening of enhancer...

...Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor (NCoR/...Cell Line Repositories (Link opens in a new window) Coriell Institute - cell line repository, including...in a new window) MMRRC Repository - NIH-supported mouse and cell line repository (Link opens in a new window...largest biorepositories (Link opens in a new window) ATCC - the world's largest cell line repository Tissue... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene disruptions...

...Resources Viral Vector Production Learn about how we produce high-quality viral vector preps at Addgene...Request service with all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification... Viral Vector Packaging Service Packaged on Request AAV Packaged...Additional Resources Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively... protection levels. We offer 963 in-stock viral vector preps, delivering high quality and ready availability...availability at affordable prices. While our repository serves the needs of many researchers, scientists sometimes... the steps to produce, purify, and titer viral vectors. Overview Our new Packaged on Request service is...

...more details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled...dCas9) can be fused to a transactivator and used as a transcriptional activator . ID Name Insert Antibiotic...Ready-to-use lentivirus available from Addgene's viral vector packaging service. Browse constructs currently ... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus... made from plasmids that are currently in our repository. You can obtain the plasmid from us or receive...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified... that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting specific...