Skip to main content

We narrowed to 18 results for: TOR;

Showing: 1 - 18 of 18 results
  1. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...Viral Vectors 101 topics More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...gamma-retroviruses, see Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically...the host genome. To produce lentiviral vectors in the laboratory, the non-required components have been...the supernatant containing the viral vectors is removed and stored or centrifuged to concentrate. You can...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral...gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors have selectable...of Viruses Viral Vector Elements More Viral Vectors 101 topics More Retroviral Vector topics Addgene protocols...Gamma-Retroviral Vectors Vector Production Integration Pseudotyping Common Uses Safety Resources Plasmid ...engineered into gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...
  3. Adenovirus Guide

    Type
    Guide
    ...Viral Vectors Adenoviral Vector Guide Adenoviral Vector Guide Jump To: Adenoviral Vectors Vector Production...Read our adenoviral vector guide to learn about adenoviral vector components, production and common uses...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...adenoviral (rAdV) vectors in order to deliver genetic cargo into cells. Most rAdV vectors are based on adenovirus...Generations First-generation rAdV vectors The first generation of rAdV vectors was developed by removing the...-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors Second-generation...Second-generation rAdV vectors contain the genomic deletions of first-generation rAdV vectors, as well as the deletion...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Viral Vectors AAV Vector Guide Adeno-Associated Viral (AAV) Vector Guide Jump To: AAV Vectors Vector Production...vitro factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...Read our adeno-associated viral vector guide to learn about AAV vector components, production and common...used as viral vectors for gene therapy applications. This guide contains many viral vector-specific terms...adenovirus, read our Adenoviral Vector Guide . Recombinant AAV Vectors Wild-type AAVs have been modified...Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning Cloning...protocols, see Addgene’s Viral Vector Protocols . Figure 3: Overview of rAAV vector production. Created with...
  5. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Receptors: RASSLs The first chemogenetic receptors were based on G-protein coupled receptors (GPCRs...References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ion channels targeted...Specifically, Receptors Activated Solely by Synthetic Ligands (RASSLs) based on κ-opiod receptors (Coward et...intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors: hM1Dq, hM3Dq...muscarinic receptors, hM2Di and hM4Di, and a Gi DREADD based on the human κ-opoid receptor, termed KORD...turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This DREADD was shown to have...DREADDs and their activity in neurons DREADD Receptor Effector Ligand Effect Outcome (in neurons) Reference...
  6. Sequencing Primers

    Type
    Guide
    ...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  7. CRISPR Guide

    Type
    Guide
    ...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in...
  8. Modular Cloning Guide

    Type
    Guide
    ...array vectors and destination vectors designed for use with the Golden Gate TALEN and TAL Effector Kit ...assembled into a Level 2 vector, forming a functional genetic circuit. Level 2 vectors are often designed with... CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in...host range vectors compatible with the CIDAR MoClo cloning standard, including a combinatorial library of...Alistair McCormick Kit containing 96 parts and acceptor vectors for generating multi-part assemblies in either... and then combined by Gibson Assembly into acceptor vectors. The Mammalian Toolkit Mammalian Expression...MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive...
  9. Plan Your Experiment

    Type
    Guide
    ...about viral vectors and their production, see our viral vector guides . Lentiviral vectors Lentiviral ...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...base editors exert their functions within a limited window from the PAM sequence, and base editor variants...CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select Your Expression ... CRISPR plasmids . Delivery Using Viral Vectors Viral vectors are a great option, as they offer high expression...
  10. Promoters

    Type
    Guide
    ...the RNA polymerase and transcription factors. Transcription factors are proteins which recruit RNA polymerase...by various DNA regulatory sequences, including enhancers, boundary elements, insulators, and silencers...sigma factors that assist the RNA polymerase in binding to the promoter region. Each sigma factor recognizes... RNA polymerase), an operator (a segment of DNA in which a repressor or activator can bind), and the structural...several transcription factors, and other accessory proteins (such as activators and structural proteins...also contains transcription factor binding sites, but mostly contains regulatory elements. Common Eukaryotic... Promoters are a vital component of expression vectors because they control the binding of the RNA polymerase...
  11. Optogenetics Guide

    Type
    Guide
    ...Depending on your answer, you'd pick an excitatory or inhibitory opsin, respectively. Color of activation...site of the viral vector, rather than in all cells. For example, using a viral vector with a floxed opsin...of optogenetics was considered to include both actuators (genetically-encoded tools for light-activated...overview, we will focus on the common optogenetic actuators used for optical control of proteins and cells...more information on biosensors such as calcium indicators or voltage sensors, visit our Biosensors Plasmid...physiological pH and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox...VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants Alternatively,...
  12. Antibody Guide

    Type
    Guide
    ...antibodies can be stored at 4 °C for short-term storage. For long-term storage they should be stored at -20 °C... Antibody Handling Storage Check the manufacturer’s instructions for exact storage requirements. As a ...tips for storing your antibody: Antibodies conjugated to fluorophores should never be stored below 4 °... antibodies should not be stored in sodium azide, as it acts as an inhibitor to HRP. In those cases, thimerosal...define key terms, summarize antibody production and storage techniques, and explain common applications. Science...expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell, and sample... a primary antibody, which becomes the limiting factor for the number of proteins you can detect in a ...
  13. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...study. Expression vectors must contain a promoter sequence, a transcription terminator sequence, and the...DLYDDDDK Thrombin LVPRGS BAD (Biotin Acceptor Domain) GLNDIFEAQKIEWHE Factor Xa IEGR or IDGR VSVG YTDIEMNRLGK...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...
  14. Molecular Cloning Techniques

    Type
    Guide
    ...entry vector containing your DNA of interest (or obtained one of the thousands of entry vectors deposited...shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase enzymes...a simple and efficient cloning method, Gateway vectors and recombination enzymes can be quite expensive...donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection markers...comes from a pre-cut, linear, cloning-ready TOPO vector that has a DNA topoisomerase I covalently bound...-ready, and it is not feasible to create a TOPO vector yourself. Additionally, the efficiency can vary...overhangs of 10–12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal, ...
  15. Addgene's eBook Collection

    Type
    Guide
    ...viral vectors contains an introduction to each vector and its applications, tips for using vectors in your...Overlay Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | ...protein; information on FRET, biosensors, and monitoring protein localization; an introduction to non-...the many career options in science, advice on mentoring and management, resources for identifying your...
  16. Educational Resources

    Type
    Guide
    ... a wide range of topics in molecular biology, laboratory research, and career development. eBooks Download... Titles include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide... How-to Blog Read about plasmids in Addgene’s repository , and related molecular biology techniques. Topics... Engineering Fluorescent Proteins CRISPR Viral Vectors Plasmid Technology Career Readiness Molecular Biology... Biology Learn about plasmids, sequencing, vectors, and restriction enzymes to assist with your molecular...
  17. Science Guides

    Type
    Guide
    ...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...
  18. Guide to Using Pooled Libraries

    Type
    Guide
    ...only a subset of genes, or very large (e.g., the Toronto KnockOut (TKO) library from the Moffat lab has ... to amplify the library, please refer to the depositor’s protocol for the best results. For some libraries...genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out our blog posts featuring ...
Showing: 1 - 18 of 18 results