We narrowed to 28 results for: Amot;
-
TypeBlog Post...filled that gap. As Sakuma and colleague Takashi Yamamoto describe in their recent study, the construction...more details on how to apply the new system, see Yamamoto and Sakuma’s protocol. Reference: Multiplex genome...system. Sakuma T, Nishikawa A, Kume S, Chayama K, Yamamoto T. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400...
-
22 Hot Plasmid Technologies from 2014
TypeBlog Post...assembly and activity? The laboratory of Takashi Yamamoto has created a complete TALEN assembly system after...using the Platinum Gate TALEN Kit, please see the Yamamoto lab’s protocol for TALEN construction. Sakuma... -
The Blue Flame Award: Celebrating Addgene's Most Requested Depositors
TypeBlog Post...at Hiroshima University who works with Takashi Yamamoto. “Addgene has made it possible to eliminate geographical... -
Fluorescent Biosensors for Measuring Autophagic Flux
TypeBlog Post...206. PubMed PMID: 17224625. Mizushima, Noboru, Tamotsu Yoshimori, and Beth Levine. "Methods in mammalian... -
Multiplex Genome Editing with CRISPR-Cpf1
TypeBlog Post...Delivery Method Advantages Disadvantages References Yamamoto Lab Golden Gate Assembly transfection One vector... -
Antibodies 101: Selecting the Right Antibody
TypeBlog Post...Lundberg E, Rimm DL, Rodriguez H, Hiltke T, Snyder M, Yamamoto T (2016) A proposal for validation of antibodies... -
Antibodies 101: Fab Fragments
TypeBlog Post...https://doi.org/10.1177/34.6.3084626 Zhang Q, Miyamoto A, Watanabe S, Arimori T, Sakai M, Tomisaki M,... -
Plasmids for Endogenous Gene Tagging in Human Cells
TypeBlog Post...and auxin-inducible degrons (AID). Further, the Yamamoto PITCh system plasmids provides an alternative ... -
Magnetic Control of Proteins: More than a Dream
TypeBlog Post...Matsuoka, R., Kimura, S., Miura, T., Ikoma, T., & Kusamoto, T. (2023) Single-Molecule Magnetoluminescence... -
Degrading DNA with Cascade-Cas3
TypeBlog Post..., Xu, H., Sasakawa, N., Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo... -
PITChing MMEJ as an Alternative Route for Gene Editing
TypeBlog Post... targeting vectors. Addgene depositor Takashi Yamamoto’s lab has harnessed MMEJ to create a new method... -
Antibodies 101: Introduction to Immunofluorescence
TypeBlog Post...Lundberg E, Rimm DL, Rodriguez H, Hiltke T, Snyder M, Yamamoto T (2016) A proposal for validation of antibodies... -
Exploring Applications of the Bioluminescent HiBiT Tag
TypeBlog Post... Kamio, T., Kono, Y., Hirosuna, K., Ozato, T., Yamamoto, H., Hirasawa, A., Ennishi, D., Tomida, S., Toyooka... -
Antibodies 101: Validation
TypeBlog Post...Lundberg E, Rimm DL, Rodriguez H, Hiltke T, Snyder M, Yamamoto T (2016) A proposal for validation of antibodies... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...the highest frequency of genome editing events. Yamamoto Lab Multiplex CRISPR/Cas9 Assembly Kit: This ... -
Antibody Validation for Flow Cytometry
TypeBlog Post.... L., Rodriguez, H., Hiltke, T., Snyder, M., & Yamamoto, T. (2016). A proposal for validation of antibodies... -
Validated gRNA Sequences
TypeCollection...24954249 Yamamoto HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto IL1RN H...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut ...TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut...TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate...TCTGTATCTATATTCATCAT 58783 cut S. pyogenes 24954249 Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 ... -
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post... https://doi.org/10.1038/nbt.3245 Nihongaki Y, Yamamoto S, Kawano F, Suzuki H, Sato M (2015) CRISPR-Cas9... -
Genetic Code Expansion
TypeCollection...Kensaku Sakamoto 197099 pIYN3 TyrRS M. jannaschii halogenated tyrosines Bacterial TAG Kensaku Sakamoto 197100...Kensaku Sakamoto 197101 pCDF-Az TyrRS M. jannaschii azidophenylalanine Bacterial TAG Kensaku Sakamoto 197102...jannaschii p-benzoylphenylalanine Bacterial TAG Kensaku Sakamoto 197566 pAcBac1-Ma-Acridone-RS1 (A7) PylRS M. alvus... -
TALEN Plasmids and Kits
TypeCollection... 1000000030 Yamamoto Lab TALEN Construction and Evaluation Accessory Pack Takashi Yamamoto This accessory...Golden Gate. Validated in several species. Takashi Yamamoto Additional Plasmids for Use with Addgene TALEN...