Skip to main content

We narrowed to 28 results for: Amot;

Showing: 1 - 20 of 28 results
  1. Introducing an All-in-One CRISPR/Cas9 Vector System for Multiplex Genome Engineering

    Type
    Blog Post
    ...filled that gap. As Sakuma and colleague Takashi Yamamoto describe in their recent study, the construction...more details on how to apply the new system, see Yamamoto and Sakuma’s protocol. Reference: Multiplex genome...system. Sakuma T, Nishikawa A, Kume S, Chayama K, Yamamoto T. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400...
  2. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...assembly and activity? The laboratory of Takashi Yamamoto has created a complete TALEN assembly system after...using the Platinum Gate TALEN Kit, please see the Yamamoto lab’s protocol for TALEN construction. Sakuma...
  3. Antibodies 101: Fab Fragments

    Type
    Blog Post
    ...https://doi.org/10.1177/34.6.3084626  Zhang Q, Miyamoto A, Watanabe S, Arimori T, Sakai M, Tomisaki M,...
  4. Degrading DNA with Cascade-Cas3

    Type
    Blog Post
    ..., Xu, H., Sasakawa, N., Naito, Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo...
  5. Antibodies 101: Validation

    Type
    Blog Post
    ...Lundberg E, Rimm DL, Rodriguez H, Hiltke T, Snyder M, Yamamoto T (2016) A proposal for validation of antibodies...
  6. Validated gRNA Sequences

    Type
    Collection
    ...24954249 Yamamoto HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto IL1RN H...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut ...TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut...TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate...TCTGTATCTATATTCATCAT 58783 cut S. pyogenes 24954249 Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 ...
  7. Genetic Code Expansion

    Type
    Collection
    ...Kensaku Sakamoto 197099 pIYN3 TyrRS M. jannaschii halogenated tyrosines Bacterial TAG Kensaku Sakamoto 197100...Kensaku Sakamoto 197101 pCDF-Az TyrRS M. jannaschii azidophenylalanine Bacterial TAG Kensaku Sakamoto 197102...jannaschii p-benzoylphenylalanine Bacterial TAG Kensaku Sakamoto 197566 pAcBac1-Ma-Acridone-RS1 (A7) PylRS M. alvus...
  8. TALEN Plasmids and Kits

    Type
    Collection
    ... 1000000030 Yamamoto Lab TALEN Construction and Evaluation Accessory Pack Takashi Yamamoto This accessory...Golden Gate. Validated in several species. Takashi Yamamoto Additional Plasmids for Use with Addgene TALEN...
Showing: 1 - 20 of 28 results