Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 23 of 23 results
  1. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial Vectors ...Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian Expression... Expression DsRed2-C1 - Mammalian Expression DsRed2-pBAD - Bacterial Expression mApple 568 592 37 6.5 ...
  2. Sequencing Primers

    Type
    Guide
    ...primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...FUS Flag, His TRE ALS Zissimos Mourelatos 51146 DsRed-p150 217-548 DCTN1 CMV ALS Trina Schroer 51221 CMV-CC2... CMV Parkinson's Ted Dawson 17706 GLASTp-DsRed2 SLC1A3 DsRed2 Episodic ataxia Nicholas Gaiano 17797 pM-ErbB4CTF...
Showing: 21 - 23 of 23 results