Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 1 - 7 of 7 results
  1. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    ...modulate cellular dynamics with light by modifying EB1. EB1 normally sits on microtubules to attract other...involved in their growth and extension. Now, they split EB1 into two halves (Fig. 1): one containing the microtubule...LOVTRAP domains. When both halves of the modified EB1 protein are overexpressed in cells, microtubule growth...to conformational changes, and as a consequence, EB1 protein function is inactivated by the separation... cancer cell line equipped with photodissociable EB1 could be stopped in areas with blue light - a finding...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... EGFP Ken-Ichi Takemaru 118084 pLenti-EB1-EGFP Microtubules EB1 EGFP Ken-Ichi Takemaru 122871 GFP-hCCDC11...beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST/LIfeAct-mCherry-N1...
  3. CRISPR Plasmids - Tagging

    Type
    Collection
    ...pFETCh_CEBPA PX458_CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human...
  4. Validated gRNA Sequences

    Type
    Collection
    ...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens...
  5. CRISPR References and Information

    Type
    Collection
    ...additional HDR & gRNA plasmids are available for CREB1, ATF1, GABPA, & RAD21 PDF 134.7 KB Musunuru CRISPRs...
  6. Immunology Research Plasmids and Resources

    Type
    Collection
    ...DCSIGNR, HP10347, L-SIGN, LSIGN, MGC129964, MGC47866 CREB1 cAMP responsive element binding protein 1 CREB, ...4, ARMD10 TLR5 toll-like receptor 5 SLE1, TIL3, SLEB1, MELIOS TLR6 toll-like receptor 6 CD286 TLR7 toll-like...
Showing: 1 - 7 of 7 results