We narrowed to 7 results for: EB1
-
TypeBlog Post...modulate cellular dynamics with light by modifying EB1. EB1 normally sits on microtubules to attract other...involved in their growth and extension. Now, they split EB1 into two halves (Fig. 1): one containing the microtubule...LOVTRAP domains. When both halves of the modified EB1 protein are overexpressed in cells, microtubule growth...to conformational changes, and as a consequence, EB1 protein function is inactivated by the separation... cancer cell line equipped with photodissociable EB1 could be stopped in areas with blue light - a finding...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... EGFP Ken-Ichi Takemaru 118084 pLenti-EB1-EGFP Microtubules EB1 EGFP Ken-Ichi Takemaru 122871 GFP-hCCDC11...beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST/LIfeAct-mCherry-N1... -
RaPID Detection of RNA-protein Interactions
TypeBlog Post.... IRE motifs are bound by IRE binding proteins, IREB1 and IREB2, which post-transcriptionally regulate... -
CRISPR Plasmids - Tagging
TypeCollection...pFETCh_CEBPA PX458_CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human... -
Validated gRNA Sequences
TypeCollection...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... -
CRISPR References and Information
TypeCollection...additional HDR & gRNA plasmids are available for CREB1, ATF1, GABPA, and RAD21 PDF, 138 KB Musunuru CRISPRs... -
Immunology Research Plasmids and Resources
TypeCollection...DCSIGNR, HP10347, L-SIGN, LSIGN, MGC129964, MGC47866 CREB1 cAMP responsive element binding protein 1 CREB, ...4, ARMD10 TLR5 toll-like receptor 5 SLE1, TIL3, SLEB1, MELIOS TLR6 toll-like receptor 6 CD286 TLR7 toll-like...