We narrowed to 21 results for: EGFP-Cre cassette
-
TypeBlog Post...protein (EGFP) reconstitution. (a) Scheme of validation for DSB mediated EGFP expression cassette reconstitution...annealing) took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330...MCS) between EGFP fragments. The pX330 plasmid contains humanized Cas9 expression cassette and sgRNA expression...halves of EGFP to recombine by homology directed repair, and resulting in the expression of EGFP. Using ...pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the ubiquitous CAG promoter. The...expression cassette. The target sgRNA can be cloned directionally into the BbsI site. (c) The pCAG-EGxxFP...indicates where your target is inserted, disrupting the EGFP fluorescent signal, for details on this plasmid,...
-
15 Hot Plasmids from 2017
TypeBlog Post...along with EGFP while retaining an emission spectrum that is easily separable from that of EGFP. This makes...kanamycin cassettes and were carefully designed to allow for easy removal of the resistance cassette via Cre...variants of the polycistronic cassettes and discovered reprogramming discrepancies, which they traced to a ...spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and empty vectors that...the transcription factors from a polycistronic cassette. However, it was unknown whether variations in...in gene expression from these polycistronic cassettes could lead to comparable experimental results. Using... Klf4 isoform (KLF4s or KLF4L). Polycistronic cassettes that contained KLF4s had overall diminished KLF4... -
Choosing Your Perfect Empty Backbone
TypeBlog Post...selection cassette for growth and cloning in bacteria and a mammalian selection cassette to screen for positive... allow you to visualize YGOI in vivo (try pcDNA3-EGFP). If you can get away with generating transiently...cells, you will not need a mammalian selection cassette (e.g. 1435 pSG5L Flag HA). You can also upgrade...with an integrating vector expressing a selection cassette with 5′ and 3′ flanking sequences matching the...fusion proteins. Pick your promoter, selection cassette and visualization vehicle to conduct your custom...your applications and experimental design. You can create a new strain with a disrupted gene by transforming... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post... how Cre-lox recombination works. Advances in Cre-lox recombination have included inducible Cre, such...possibilities. The remaining cassette can invert as long as Cre remains expressed; once Cre is removed from the...Cai et al. also created an Autobow construct containing both Cre and XFPs. Cre production drives recombination...continued utility of Cre-lox. Check out our previous blog post, Plasmids 101: Cre-lox, if you need a quick...membrane tethered cyan). Without Cre recombination, RFP is expressed. Cre can mediate one of two deletions...construct, OFP (orange), is expressed when Cre is absent; stochastic Cre excision results in one of three recombinations...system employs Cre-mediated deletion, the design of Brainbow-2.1 cleverly combines Cre-mediated deletion... -
Zhang Lab CRISPR Page
TypeCollection...backbone with Cre recombinase 60230 : sgRNA targeted to NeuN, plus Cre recombinase-2A-EGFP-KASH 60231 :...pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase...sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes, Cre recombinase and...sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes, Cre recombinase and...(backbone)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes, Cre recombinase and...ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and... -
Hot Plasmids - June 2020 - Barcoded CRISPR Library, Sparse Cell Labeling, Calcineurin Reporter, and DNA Staining Dye Alternative
TypeBlog Post...remove a stop cassette upstream of an effector/reporter gene. In cells where the stop cassette is removed...fluorescent protein to the DNA. They created plasmids for purification of tTALE-eGFP and tTALE-mCherry. In comparison... Figure 1: Initial steps in the CRISPR-pooled screening using sgRNAiBAR. Image from Zhu et al., 2019. ... Peking University has developed a new CRISPR screening method that makes use of guide RNAs with internal...false-positive rate discovery rate, conventional CRISPR screens require a low multiplicity of infection (MOI) during... annotated human gene, it enables genome-wide screening with a high MOI, which is beneficial for a low... calcineurin dynamics and can serve as a drug-screening platform to identify new antifungals that target... -
Lentivirus Plasmids
TypeCollection...article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can ... pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns on shRNA expression...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...expression of EGFP and the gene of interest, also can express shRNA (cloning H1-shRNA cassettes into the unique...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid... -
Plasmids 101: Knockout/Knock-In Plasmids
TypeBlog Post...want to create a conditional knockout. To make a conditional knockout, researchers often use the Cre/Lox ...resistance cassette has been placed into an intron. Figure 4: A targeting vector to create a floxed...researchers usually remove it after selection using the Cre/Lox recombination system. After “floxing” the resistance... you can remove the gene through the addition of Cre recombinase (Figure 2). Figure 2: A knockout...so that it can be removed post-selection through Cre-mediated recombination. Knockout/Knock-in...targeted gene. Upon recombination, the GFP/NeoR cassette is inserted in place of exon 2. Thus, the targeted...example, you can remove a floxed resistance gene using Cre recombinase. If GFP is under control of an endogenous... -
Plasmids 101: Multicistronic Vectors
TypeBlog Post...individual expression cassettes, having the genes expressed from the same cassette is sometimes advantageous...Multicistronic Element Expression Type MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral...and you can then insert the whole multicistronic cassette into a backbone as a single unit. Although it ... or the creation of bicistronic or multicistronic vectors. Unlike promoters which will create unique mRNA...resistance gene. These reporters allow you to easily screen or select for cells that are expressing your gene...interest at high levels. Unlike vectors that express screenable or selectable markers from a unique promoter,...now download Addgene's new eBook! Our goal was to create a one-stop reference guide for plasmids. We've ... -
CRISPR Plasmids - Tagging
TypeCollection...system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous proteins...vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences and...deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin (FBL... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen...vector assembly, and the remaining 5 plasmids include Cre and FLP expression vectors, a general cloning plasmid...cells that uses PCR to generate both an expression cassette for the Cas9-programming sgRNA and HR donors for... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2 74010 Zebrafish U6 yes, cut S. pyogenes Cre Del ...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9... guide RNA expression cassettes and a Cas9 nuclease/nickase expression cassette using the Golden Gate ...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ... -
Sequencing Primers
TypeGuide...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...express self-excising Cre recombinase from the same transgene as the Brainbow cassette, simplifying experiments... short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated recombination to turn on or off the expression...a dual-color RNAi “sensor” mouse strain in which Cre expression causes the induction of both DsRed fluorescence...Mice carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre alleles showed efficient GFP knockdown in eyes and...sequence to be integrated and a removable integrase cassette. They validated this methodology in two differents... recombination events at the genetic level. Upon Cre/loxP recombination, each transgene expresses one ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined ...separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...result in a translational fusion of the antibiotic cassette to the gene of interest. The gene to be expressed... missing codons from the antibiotic resistance cassette, a ribosome binding site, SacI restriction site...heterologous promoter outside of the Multisite Gateway® cassette, you can specifically express your new chimeric...scientists to target RNA-based protein-binding cassettes, artificial aptamers, pools of random RNA sequences...utilize a U6 promoter and contain the RNA cargo cassette inserted within the sgRNA core (ie an INT construct... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog Post...commonly used cassettes, such as fluorescent proteins (EGFP, mCherry etc.), recombinases (Cre, Flp etc.),...But CRISPRing typical mouse models, including creating Cre-dependent conditional alleles, has remained ..., we’ll use the example of inserting a 2A-FlpO cassette into the Fgf8 gene. Miura et al. (2018) suggest...plasmid pmScarlet_C1! After creating the T7-DNA template, you'd use ivTRT to create the ssDNA construct as ...CRISPR genome editing has made it easier to create knockout alleles in a variety of species, including...repair template is used. The original design for creating a conditional allele, or floxed mouse, from Yang... and inject the ES cells into a mouse embryo to create chimeric mice. This laborious process takes ~8-... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...fly. As a stop cassette is located directly upstream of the fluorescent protein genes, Cre recombination...developing fish via Cre protein microinjection or crossing of Zebrabow animals to an inducible Cre line. The Schier...OFP (orange) (Livet et al., 2007). Brainbow uses a Cre/lox system to label neurons. Genes encoding the fluorescent...gene directly following the promoter is expressed. Cre-mediated deletion of one or several of these genes...system. One such system is Brainbow 2.0, which uses Cre to trigger the inversion of two genes aligned head-to-head...head-to-head. Another variation, Brainbow 2.1, uses Cre to trigger the inversion of two tandem sets of genes...incorporates the highly photostable fluorophores mOrange2, EGFP, and mKate2 (red) to solve the problematically low... -
Hot Plasmids - February 2022
TypeBlog Post...within a single cassette provides increased simplicity for combinatorial genetic screens, and this optimized...perform multiplex editing within a single expression cassette is advantageous to Cas9’s larger expression requirements...2: comparison of Cas 9 vs. Cas 12a expression cassettes when encoding multiple guides. While two guides...expanded the genetic screening toolkit by optimizing a Cas12a-based method for screens. Cas12a’s ability ...underutilized in genetic screens because of its lowered editing rate. This research aimed to increase the potential...parallel. Lastly, this Cas12a-based screening method was used to create a genome-wide library capable of ...imaging of cellular targets Optimized genetic screening technique using Cas12a for multiplexed gene perturbation... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...blue fluorescent protein 35S-eGFP-nosT - Transient expression vector for eGFP in plants Find FP tagging ...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060...Lentiviral shRNA expression pLJM1-EGFP - 3rd gen lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin...scientists often want to create stable cell lines in which the expression cassette of interest is incorporated...Expresses mCherry tag in mammalian cells pBI-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones...proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression pLV-mCherry...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' ... -
Zebrafish Plasmid Collection
TypeCollection...resistant cell types. CreLite - George Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that ...toolbox of genetic methods, such as Tol2 transposons, Cre-mediated site-specific recombination, morpholinos...fluorescent proteins, reporters, biosensors, and Cre expression plasmids. Large collections or kits are...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 Gateway-compatible Kit ...that are amenable to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox... Amro Hamdoun Lab. A useful “starter kit” for screening fluorescent protein fusion expression in organisms... -
CRISPR References and Information
TypeCollection...pCFJ90 (pharyngeal co-injection marker); pDD104 (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid ...cloning All-in-one plasmid containing expression cassette for NmCas9 and BsmBI site for cloning in gRNA:...plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human and...- a CRISPR Screen Tool (Link opens in a new window) Design gRNAs for custom CRISPR screens targeting a...in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's downloadable eBook about...CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation, inhibition...