Skip to main content
Addgene

We narrowed to 17 results for: EcoRI

Showing: 1 - 17 of 17 results
  1. Plasmid Cloning by PCR

    Type
    Blog Post
    ...graphically in the following figure, in which we add EcoRI and NotI sites to Your Gene of Interest (YGOI) for...will save time later In our example, we will use EcoRI and NotI to ligate our cDNA into the recipient plasmid...the region that binds the ORF and we will add the EcoRI restriction site (GAATTC) to the 5’ end of this ...
  2. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ... insert with EcoRI and HindIII and, when you mix the cut products together, the two EcoRI digested ends... (blue arrow) followed by the restriction sites EcoRI, XhoI, and HindIII. To place your gene in the proper...orientation downstream of the promoter, you can add an EcoRI site just 5’ of the start of the gene and a HindIII...
  3. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...alleviates RBS-CDS issues. Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI Restriction Sites to Avoid: NotI...in E. Coli genome. Prohibited Restriction Sites: EcoRI, SpeI, NheI, PstI Restriction Sites to Avoid: PvuII...high-efficiency enzymes. Prohibited Restriction Sites: EcoRI, BglII, BamHI, XhoI For more info, visit iGEM: BglBrick...encoding Thr-Ala. Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI For more info, visit iGEM: Silver... N-term sequence. Prohibited Restriction Sites: EcoRI, XbaI, NgoMIV, AgeI, SpeI, PstI For more info, visit...
  4. MXS Chaining

    Type
    Blog Post
    ... BioBricks SpeI and XbaI EcoRI and PstI Bglbricks BglII and BamHI EcoRI Additional Resources ...
  5. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...favorite vector has a relatively limited MCS (BamHI - EcoRI - SalI) and you want to expand that with the addition...add NdeI, PacI, AscI and MfeI sites between the EcoRI and SalI sites of the vector, we design a top oligo...overhangs generated when digesting the vector with EcoRI and SalI (see diagram ). To do this, we add 5' ...of the other oligo), but this would destroy the EcoRI and SalI sites in the final vector. Order the following...conduct a restriction digest of 1μg of vector with EcoRI and SalI. Run an agarose gel and cut out the band...
  6. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ... digest with EcoRI and NcoI: 1 μg miniprep DNA 2 μL 10x NEB buffer for EcoRI 0.8 μL EcoRI 0.8 μL NcoI ...digestion with AgeI and EcoRI. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer...with EcoRI. Mix: 30 μL pLKO.1 TRC-cloning vector digested with AgeI 5 μL 10x NEB buffer for EcoRI 1 μL...cases (depending on the target sequence), while the EcoRI site is preserved. For a complete map of pLKO.1 ...1.9kb stuffer that is released upon digestion with EcoRI and AgeI. The oligos from section B contain the ...sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed...catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI NEB #R0101S NEB buffer 1 NEB #B7001S NEB buffer ...
  7. Open Enzyme Collection

    Type
    Collection
    ... Addgene ID Plasmid Gene/insert 165504 pOpen-EcoRIR EcoRI 165506 pOpen-Eco31I Eco31I 165507 pOpen-NotIR...Vaccinia Virus DNA Topoisomerase 1B 165515 pOpen-EcoRIM M.EcoRI DNA methyltransferase 165517 pOpen-Eco31IA ...
  8. Sequencing Primers

    Type
    Guide
    ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upsteam of EcoRI site, forward primer pBRrevBam GGTGATGTCGGCGATATAGG... pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG...
  9. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...in the following cartoon, in which we are adding EcoRI and NotI sites to Your Gene of Interest (YGOI) for...will save time later. In our example, we will use EcoRI and NotI to ligate our cDNA into the recipient plasmid...the region that binds the ORF and we will add the EcoRI restriction site (GAATTC) to the 5’ end of this ...
  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono pMB60 47941 Worm BsaI none...Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089 Mammalian...
Showing: 1 - 17 of 17 results