... bind to GAL4, partially inhibiting the binding of GAL4 to UAS. One can therefore place GAL4 and GAL80...common binary system is the GAL4/UAS system isolated from yeast. In this system, UAS basal promoter expression...expression is low but is activated by GAL4 binding to UAS. If you place the GAL4 gene downstream of a tissue- ...to intermediate expression from QUAS, as seen with GAL4/GAL80 and UAS. QF-mediated repression is reversible...phase of yeast culture. Repressible Binary Systems GAL4/UAS In Drosophila or development studies, you may ... Lee. LexA/lexAop is a complementary system to GAL4/UAS that functions in essentially the same manner,...activators of lexAop. This system is commonly used with GAL4/UAS to examine the expression of reporter genes, or...

...1):  GAL4-UAS, a transcription factor binding site. GAL4 expressed in the fly binds to the UAS binding...SPARC Figure 1: SPARC and SPARC2 use the GAL4-UAS system along with precisely truncated attP sites...transcription activation systems, such as LexA/p65 or mCD8/GFP, to allow sparse labeling in a variety of fly cell...

...GBPs/GFP. The new system, CRE-DOG (Cre Dependent On GFP), is activated by GFP and derivatives GFP and ...to bind GFP. The idea of using GFP as a scaffold suddenly seemed very realistic. Envisioning GFP as a substrate...presence of GFP. These systems, known as T-DDOG and Cre-DOG, respectively, repurpose popular GFP reporter...lines expressing GFP in specific cell types to do more than just label cells. If GFP could be co-opted...selectively manipulate only GFP-labeled cells. Once Tang and Cepko found a description of GFP-binding nanobodies...tested pairs of their GFP-binding proteins (GBPs) to find those that could co-occupy GFP. Once they’d found...GBPa-VP16 (activation domain); GBPb-GAL4 (DNA-binding domain); and a UAS-driven luciferase reporter construct...

...transactivator is used. UAS General expression mRNA Yeast promoter containing Gal4 binding sites, commonly... in Drosophila Specific Requires the presence of Gal4 gene to activate promoter. Ac5 General expression... be used independently or together. Regulated by GAL4 and GAL 80. TEF1 General expression mRNA Yeast...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...

...integration into the fly genome and are under the Gal4 inducible UAS promoter. Other vectors can be expressed ...using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression pattern... allow you to visualize YGOI in vivo (try pcDNA3-EGFP). If you can get away with generating transiently...

...activation sequence (UAS) of its target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless...Although the original Y2H systems utilized the yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter...the binding sites for the protein partner or the UAS/reporter gene, the same bait and prey libraries can...

... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...

...Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans . Synthetic Biology Synthetic...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...

... Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...Plant Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...- Epitope tagging in S. pombe Insect/Baculovirus UAS, MT, Polyhedrin Targeted Gene Expression...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization... cells, integrate into host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for ...

... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...