Skip to main content
Addgene

We narrowed to 28 results for: Mbp

Showing: 1 - 20 of 28 results
  1. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ... from solution. MBP antibodies are available for detection and/or purification of MBP-tagged proteins....Maltose binding protein Maltose binding protein (MBP) is a 45 kDa tag which can be purified (along with...with its fusion protein) with amylose resin. The MBP tag, although large, can actually increase expression...which can be isolated with glutathione resin. Like MBP, it can be removed via protease cleavage at sites...sites immediately following the tag. Unlike MBP, the GST tag can be cleaved off from the fusion protein while...fusion proteins from being purified by GST (maybe try MBP if you are having solubility issues!). Need a GST...
  2. In Vivo Biotinylation of Bacterial Fusion Proteins

    Type
    Blog Post
    ...interest fused to maltose binding protein (MBP, New England BioLabs). MBP has a similar function as GST in that...the fusion protein from a bacterial extract. The MBP tag can be removed using Xa protease. The carboxyl-terminus...AB3596) and mouse (NEB, E8032S) antibodies against MBP are commercially available. Factor Xa loves calcium...
  3. CRISPRainbow and Genome Visualization

    Type
    Blog Post
    ...genes over time, at a range of distances from 2-75 Mbp. Labeling multiple, intrachromosomal loci Building...resolved loci with physical map distances of 2 and 75 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ...
  4. Mapping the 4D nucleome with CRISPR/Cas9

    Type
    Blog Post
    ...resolved loci with physical map distances of 75 and 2 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ...
  5. Plasmids 101: Protein tags

    Type
    Blog Post
    ...and stabilization, as can maltose-binding protein (MBP). Overexpression can also lead to insolubility, and... and aggregated protein is not useful protein. MBP tags can help with solubility issues, but scientists...(Bio), flanked by hexahistidine motifs (6xHis) MBP Large Protein  40 Solubility and Purification Can...
  6. Hot Plasmids - August 2020

    Type
    Blog Post
    ...peptide of MBP, followed by the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal ...
  7. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...S68TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68300 MBP-MEK1 Plasmid 68299...68283 SepOTSβ Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Strain 52055...
  8. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...made by Addgene MBP Protein purification pET28-MBP-TEV - Bacterial expression with MBP-TEV N-terminal ...pDEST Gateway vectors - For the production of His6-MBP-tagged fusion proteins in E. coli SUMO Protein purification...
  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Rosenbluh 98651 MBP-FUS_FL_WT FUS His, MBP T7 ALS Nicolas Fawzi 98652 MBP-FUS_FL_12E FUS His, MBP T7 ALS Nicolas...Fawzi 98653 MBP-FUS_LC_WT FUS His, MBP T7 ALS Nicolas Fawzi 98654 MBP-FUS_LC_12E FUS His, MBP T7 ALS Nicolas...98661 MBP-hnRNPA2_LC HNRNPA2B1 His, MBP T7 Multisystem proteinopathy, ALS Nicolas Fawzi 98662 MBP-hnRNPA2...atrophy Greg Matera 38005 pET-21a(+)/MBP-His-PINK1 PINK1 His, MBP T7 Parkinson's Michael J Fox Foundation...PARK7 His T7 Parkinson's Mark Wilson 61090 MBP-mmA1 HNRNPA1 MBP ALS Sean Ryder 61155 C1A-C1A-EYFP PRKCG ...Alzheimer's Thomas Wassmer 69927 pET28-MBP-TEV-AICD APP TEV, MBP T7 Alzheimer's Thomas Wassmer 70625 R777...Nicolas Fawzi 98655 MBP-FUS_FL_6E FUS His, MBP T7 ALS Nicolas Fawzi 98656 FUS_anion FUS T7 ALS Nicolas ...
  10. Sequencing Primers

    Type
    Guide
    ...AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab) 3' end of ...
  11. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...), gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...
  12. Bacterial Expression Systems

    Type
    Collection
    ...Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease...
  13. Twenty Years of Sharing Science!

    Type
    Blog Post
    ...first request was on September 8, 2004 (for pcDNA-p160MBP, if you're curious.) Since then, we've distributed...
Showing: 1 - 20 of 28 results