Skip to main content
Addgene

We narrowed to 103 results for: UBC

Showing: 1 - 20 of 103 results
  1. Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles

    Type
    Blog Post
    ...and selected subcellular marker proteins, it’s possible to get an idea about the subcellular structures ...protein function. Getting ready to determine the subcellular localization of your protein of interest The ... vesicles via the secretory pathway to their subcellular or extracellular destination. At the end of their...proteins tagged with FPs to highlight various subcellular structures. Please see Figure 1 for commonly ...inert fluorescent protein fusions to visualize subcellular structures. For example, you might use your fluoresent...particular gene. For subcellular markers in yeast see our plasmid collection from...You can find more plasmids for labeling your subcellular structure of interest in the Allen Institute ...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...proteins tagged with genes or peptides with known subcellular localization patterns. Useful for co-localization...Proteins Organelle Markers Fluorescent Proteins: Subcellular Localization More Fluorescent Protein Resources...Cytoskeletal Junctions Secretory Pathway Background The subcellular localization of a protein is often tied to its...There are a variety of methods for determining subcellular localization. One of the most common is to use...proteins that are targeted to various organelles or subcellular structures. You should fuse your protein of interest...The cell contains a variety of organelles and subcellular structures each with their own unique function...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Renilla Ubc Lentiviral Expression of Renilla luciferase Rudolf Jaenisch 113450 pLenti NL NanoLuc® Ubc Lentiviral... luciferase Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression of firefly luciferase...luciferase Reuben Shaw 48688 pUltra-Chili-Luc Firefly Ubc Lentiviral expression of firefly luciferase and dTomato...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's Baoji...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's Baoji...FUGW-APPwt-T2A-mCherry APP mCherry UbC Alzheimer's Ronald Hart 190804 FUGW-APPSwe-T2A-mCherry APP mCherry UbC Alzheimer's Ronald...FUGW-APPSwe-T2A-Hygro APP UbC Alzheimer's Ronald Hart 190806 FUGW-APPIce-T2A-mCherry APP mCherry UbC Alzheimer's Ronald...APOE mCherry UbC Alzheimer's Ronald Hart 190808 FUGW-APOE-E3-T2A-mCherry APOE mCherry UbC Alzheimer's ...T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190810 FUGW-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald...pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190812 pTet-O-APOE-E3-T2A-Puro APOE UbC Alzheimer's Ronald...
  5. Tetracycline Inducible Expression

    Type
    Collection
    ...FUW-M2rtTA Lentiviral Tet-On vector, expressing rtTA from UbC promoter rtTA-Advanced Rudolf Jaenisch 25434 pMA2640...
  6. Sequencing Primers

    Type
    Guide
    ...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...
  7. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...enzyme digest (subcloning), including design and experimental procedures.... Protocols Subcloning Plasmid Cloning...Cloning by Restriction Enzyme Digest (aka Subcloning) You may also like... Restriction Digest of Plasmid...out our Empty Backbone Reference . Background Subcloning by restriction digest is a commonly used lab ...YGOI is in a bacterial expression vector. Using subcloning, you can easily move YGOI into a mammalian expression...find two different restriction enzymes for your subcloning. It is also possible to use a single enzyme, ...
  8. General Transfection

    Type
    Protocol
    ...function. We specifically use this protocol with a subclone of HEK293T cells optimized for viral production...Workflow Timeline Day 0: Seed HEK293T cells (or a subclone of HEK293T optimized for viral production) Day...
  9. Building and Validating Recombinant Antibodies: A Case Study

    Type
    Blog Post
    ...different subclasses, but there are also secondary antibodies that are specific to each subclass. Approximately...mouse mAbs are IgG1 subclass (Manning et al. 2012), which limits the use of subclass specific secondary...backbone to generate R-mAbs of different subclasses, including subclasses that were not produced by the original...original hybridoma. By using subclass specific secondary antibodies and subclassed switched R-mAbs, multiple...engineered. Like humans, mice express multiple subclasses of IgG antibody. Broad range secondary antibodies...  Fig. 2. Multiplex immunolabeling with subclass-switched recombinant antibodies in adult rat brain...KD, Engebrecht J, Trimmer JS. A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...
  10. Plasmids 101: Secondary Nanobody Toolbox

    Type
    Blog Post
    ...different species, or at least from different IgG subclasses, so that secondary antibodies exclusively recognize...Must use different species and/or different IgG subclasses of 1° for multi-color staining Can be expensive...limited cross-reactivity between different IgG subclasses and different species, nanobodies are useful ...require using primary antibodies from different IgG subclasses. Instead, you can pre-incubate individual primary...antibody: species it was raised in and its IgG subclass. Once you know the answer to these two questions...right nanobody for your work. Species Antibody Subclass Nanobody Addgene Plasmid Rabbit N/A* TP897... (3x cysteines) *Rabbits have only one IgG subclass.   Express the Nanobody In Bacteria: Table 2 also...
  11. Antibodies 101: Isotypes

    Type
    Blog Post
    ...and α. Some isotypes have different versions or subclasses that have minor differences in their heavy chain...the hinge region in IgM antibodies. IgM has no subclasses and is found mostly in blood. IgD While IgD is...monomer structure with a valency of two and has no subclasses. IgG IgG is the most abundant isotype in blood...monomer with a valency of two. There are four IgG subclasses, numbered based on their abundance in blood: ...involved in allergic reactions. There are no IgE subclasses and they are expressed as monomers with a valency...dimer with a valency of four. There are two IgA subclasses: IgA1 and IgA2.  You can learn more about isotype...
  12. Antibodies 101: Choosing the Right Isotype

    Type
    Blog Post
    ...antibodies contain a mix of different isotypes and subclasses. They each have their own advantages. Since monoclonal...species, like an anti-mouse IgG antibody. Some are subclass specific, like an anti-mouse IgG2a antibody. When...    Figure 1: Broadly reactive versus subclass-specific antibodies. Only a fraction of the antibody... antibody (A). To boost signal, consider using subclass specific secondary antibodies instead (B). ...antibody contains a mix of different isotypes and subclasses, use a broadly reactive secondary antibody to...antibody you may wonder, “Will the isotype, and subclass affect my experiment?” Well, it depends on the...
  13. Common Injection Routes in Mice

    Type
    Blog Post
    ...0.02–0.05 ml Skill required: beginner Subcutaneous Subcutaneous (SQ or SC) injections are given between...method, subcutaneous injections take some practice to get the coordination down. Subcutaneous injections...restrainer Thigh 25–27 < 0.02–0.05 mL Beginner Subcutaneous Back scruffing or mechanical restrainer Back...
  14. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    ...same bottle of serum again and again for each subculture can enhance the growth of mycoplasmas. The serum...generated will enter the culture medium during subculturing processes or from the air if the cell line remains...source of the problem is the media, used for subculturing, which is available in both liquid and powdered...contamination present in the serum to be used for subculturing. Avoid using expired products or reagents that...viability of cryopreserved cells decreases with every subculture. Equipment Fumigate the laminar airflow and...
  15. Hot Plasmids - May 2022

    Type
    Blog Post
    ... own subclone, they were able to develop a 12-plex multiplex imaging system. Mixing the subclones within... a fluorescent protein coupled to a specific subcellular localization peptide. By combining three different...their work with the “signalome,” a 12-plex mixed-subclone system using mStrawberry, localization peptides...
  16. Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy

    Type
    Blog Post
    ...BiFC studies used the method to interrogate the subcellular localization of interactions between basic leucine...fusion proteins it requires can lead to aberrant subcellular localization of the studied PIPs. The straightforward...endogenous counterparts using western blotting. The subcellular localization of BiFC constructs should also be...because their expression level, stability, and subcellular localization may differ from those of your BiFC...
  17. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...check its subcellular location and solubility. If it’s membrane-bound or located in a subcellular compartment...strengths. If that’s not working, consider using a subcellular fractionation kit or a lysing protocol developed...strength Sonication based lysing protocol Subcellular fractional kit or lysing protocol Not enough...
Showing: 1 - 20 of 103 results