We narrowed to 17 results for: Ubiquitin-C promoter

...auxin binds to TIR1 of the SCF-TIR1 ubiquitin ligase complex, promoting its interaction with the degron sequence...have this response, they do contain the specific ubiquitin ligase pathway needed for AID. By tagging proteins...cells, which interacts with the cells’ endogenous ubiquitin ligase, the Kanemaki lab was able to translate...studying the effects of endogenous looping on distal promoters and enhancers, or have attempted to engineer loops...LADL Anchors to genomic targets, such as a distal promoter and an enhancer. What makes LADL unique from previous...group targeted the enhancer region of Klf4 and the promoter region of Zfp462, which are over 500kB apart, ...please sign up here.        New toolkit for N or C terminal tagging of proteins for degradation using...

...Mammalian promoter from the human ubiquitin C gene Constitutive  As the name implies, this promoter is ubiquitous... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...

...inhibitor response 1 (TIR1) expressed under a desired promoter with a specific spatiotemporal expression pattern...endogenous Skp1 and Cul3 proteins to form a SCF E3 ubiquitin ligase complex. In the presence of auxin, this...developed a chemogenetic system that brings Cas9 to ubiquitin ligase for degradation.      New from the viral...interactions New auxin inducible degron system for C. elegans New CRISPR plasmids New items from the viral...tool-kit for the auxin inducible degron (AID) system in C. elegans By Alyssa Cecchetelli The auxin inducible... degron (AID) system has been extensively used in C. elegans since 2015 to conditionally degrade proteins...

...degradation tag (dTAG) system, to co-opt the endogenous ubiquitin proteasome machinery to degrade any protein. We...formation between the FKBP12F36V-fusion and the ubiquitin proteasome machinery through binding with cereblon... al. YY1 Is a Structural Regulator of Enhancer-Promoter Loops. Cell. December 14 2017. 171(7):1573-1588...These plasmids enable lentiviral expression of N- or C-terminally FKBP12F36V-tagged fusion chimeras or locus-specific... rapid means of comparing functionality of N- and C-terminal fusions and degradation in a cell line of...proximity with the target protein, leading to polyubiquitination of the target protein and proteasomal degradation...

... repeat domain 2 (RFWD2); E3 ubiquitin protein ligase cytoC Cytochrome c DR5 Tumor necrosis factor receptor... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...family B member 5 MDM2 MDM2 proto-oncogene, E3 ubiquitin protein ligase MDMX p53 regulator; also known ...CHY zinc finger domain containing 1 (RCHY1); E3 ubiquitin protein ligase PTEN Phosphatase and tensin homolog... SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1...Ghebranious N, Igelmann H, Lu X, Soron G, Cooper B, Brayton C, Park SH, Thompson T, Karsenty G, Bradley A, Donehower...

...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection... Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA...pNIC-CTHF - C-terminal TEV-His6-Flag for bacterial expression pFA6a vectors - PCR-based C-terminal...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...

... cauliflower mosaic virus 35S promoter (CaMV 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene...doi.org/10.1038/s41467-020-15731-w Wang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu Y-G, Zhao K (2016) Enhanced...https://doi.org/10.1073/pnas.1818290116 Zhu H, Li C, Gao C (2020) Applications of CRISPR–Cas in agriculture...consistent between plants and other organisms, but the promoter used to drive gRNA expression is dependent upon...gRNA downstream of a plant-specific RNA pol III promoter, such as AtU6, TaU6, OsU6 or OsU3, which are commonly... gRNA” backbones which contain a plant pol III promoter and gRNA scaffold sequence and allow researchers...is commonly driven by plant-derived RNA pol II promoters which regulate expression of longer RNAs (such...

...El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C., Ellerbrok, H., Kamuzinzi, R., Ledent...contains a reporter gene cloned downstream of a promoter containing the target sequence of the DBD. The...as the “prey”) in close enough proximity to the promoter of the reporter gene to activate expression (Figure...requirement for transmembrane proteins, a split ubiquitin system has been devised (8). References 1. Casadaban...organisms, including bacteria, alternative fungi (C. albicans, pC2HB) (7) and mammalian cells. If the ... prey libraries can be screened using both N- and C-terminal fusions of these proteins. This way both ...

...with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical abbreviations: Gr= Gracile tract...Deisseroth. (2014) Nat Protoc., 9, 1682-1697. Pubmed. C. Soderblom, D.-H. Lee, A. Dawood, M. Carballosa, et...

...crystallizing it or testing its function. Small ubiquitin-related modifier (SUMO) can help with folding ...amino acid protein  12 Stability At N-terminus, promotes folding and structural integrity; cleavable. Not...tag to it. The FLAG, hemaglutinin antigen (HA), and c-myc tags have been the workhorses of the affinity ... tags, a His tag can be fused to either the N- or C-terminus of a protein. Unlike other epitope tags –...

...HiBiT is compatible with both strong and weak promoters, and even modest endogenous pools generate high...The authors investigated the role of cytosolic ubiquitin ligases in the degradation of CFTR, specifically...Machleidt, T., Robers, M. B., Benink, H. A., Eggers, C. T., Slater, M. R., Meisenheimer, P. L., Klaubert,...657–661. https://doi.org/10.1038/nmeth.4344  Peach, C. J., Kilpatrick, L. E., Woolard, J., & Hill, S. J....-proteins-using-hibit-crispr-cell-lines/ Shibata, C., Otsuka, M., Shimizu, T., Seimiya, T., Kishikawa,...

...ligand binding assays, phage display assays, ubiquitination activity assays, toxin activity, small molecule...interest. A low primer-to-template ratio is used to promote annealing of one primer to each template. The PCR..., E. O., Williams, B. A., Zhang, J., & Chaput, J. C. (2010). “Random Mutagenesis by Error-Prone PCR”. ...

...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...expression of firefly luciferase from the Zea mays ubiquitin promoter. Paul Schulze-Lefert 83282 pAAV-CAG-RLuc ...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow... Renilla Dual reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...

...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked... a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding ...Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic...cross-compatible plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible RBSs...Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms in E. coli ... nucleases, base editors, gRNA backbones, and promoters for genome editing in monocots and dicots. pDGE...Patron at The Sainsbury Laboratory Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning...

...CCL1 chemokine (C-C motif) ligand 1 I-309, P500, SCYA1, SISe, TCA3 CCL11 chemokine (C-C motif) ligand 11...chemokine (C-C motif) ligand 13 CKb10, MCP-4, MGC17134, NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif...chemokine (C-C motif) ligand 19 CKb11, ELC, MGC34433, MIP-3b, MIP3B, SCYA19 CCL2 chemokine (C-C motif) ligand...chemokine (C-C motif) ligand 20 CKb4, LARC, MIP-3a, MIP3A, SCYA20, ST38 CCL21 chemokine (C-C motif) ligand...CCL24 chemokine (C-C motif) ligand 24 Ckb-6, MPIF-2, MPIF2, SCYA24 CCL25 chemokine (C-C motif) ligand 25...chemokine (C-C motif) ligand 26 IMAC, MGC126714, MIP-4a, MIP-4alpha, SCYA26, TSC-1 CCL27 chemokine (C-C motif...CCL28 chemokine (C-C motif) ligand 28 CCK1, MEC, MGC71902, SCYA28 CCL3 chemokine (C-C motif) ligand 3 ...