Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 19 results for: ampicillin

Showing: 1 - 19 of 19 results

  1. Plasmids 101: Antibiotic Resistance Genes

    Type
    Blog Post
    ...Carbenicillin is more stable than Ampicillin and can be used in place of Ampicillin in most applications. Antibiotics...protein synthesis Bactericidal 25-100 ug/mL Ampicillin beta-lactam Inhibits cell wall synthesis Bactericidal...most antibiotics viable for at least 6 months. Ampicillin breaks down especially fast and plates should...

  2. Plasmids 101: Screening Strategies Used in Plasmid Cloning

    Type
    Blog Post
    ...contains an ampicillin resistance marker in the backbone. A selection on agar containing ampicillin will yield...on this below). Plating the transformation on ampicillin plates containing X-gal allows you to identify...

  3. Save Time and Money by Making Your Own Competent Cells

    Type
    Blog Post
    ...yourself time if you're transforming a plasmid with ampicillin resistance.  After a plasmid is introduced to...transformed cells are being plated on agar with ampicillin selection.  Notes and tips  We’ve found that...

  4. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...issue. The genes and their antibiotics   Ampicillin Ampicillin, often just called amp, is the historical... with most bacteria? No satellite colonies? Ampicillin Fair {% icon icon_set="fontawesome-5.14.0" name...

  6. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...44251 pgRNA-bacteria BBa_J23119 SpeI + HindIII Ampicillin none, need Cas9 plasmid Qi Do you have suggestions...

  7. Open Enzyme Collection

    Type
    Collection
    ...marker for all plasmids in this collection is ampicillin. Find more information on the enzymes and protocols...

  10. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ..., beta-lactam antibiotics like penicillin and ampicillin inhibit cell wall synthesis. Eukaryotes, with...

  12. Pouring LB Agar Plates

    Type
    Protocol
    ...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Bleocin 5 mg/mL 5 µg/mL Carbenicillin...dH 2 O. *Carbenicillin can be used in place of ampicillin. Carbenicillin is more stable, so it is potentially...plates with a final concentration of 100 ug/mL ampicillin, you should make a stock solution of 100,000 .../mL (100 mg/mL). Simply measure out 100 mg of ampicillin powder, add it to 1 mL of water, dissolve by ...

  13. Molecular Biology Reference

    Type
    Guide
    ...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL ... *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create a stock solution...

  14. Protocol - Bacterial Transformation

    Type
    Protocol
    ...containing agar plate. This step is not critical for Ampicillin resistance but is much more important for other...heat-shock Shorten or skip the outgrowth (for Ampicillin resistance it is ok to completely skip the outgrowth...

  15. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog). Due to the long terminal...ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection of pLKO.1 plasmid... agar) American Bioanalytical: #AB01200-02000 Ampicillin VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin...colonies from each ligation into LB + 100 μg/mL ampicillin or carbenicillin. Day 2: 2. Spin down the cultures...Autoclave and cool to 55°C. Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration...

  18. Sequencing Primers

    Type
    Guide
    ...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...
Showing: 1 - 19 of 19 results