...ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658...

... class II molecules found on the surface of APC. BCR Signaling B cells mediate humoral immunity through...recognize specific antigens through the B cell receptor (BCR). The strength and duration of signaling controls... and can lead to the formation of a high avidity BCR through repeat cycles of expansion. Chemokines Chemokines...ULBP3 UL16 binding protein 3 RAET1N Return to top BCR Signaling B cells mediate humoral immunity through... and can lead to the formation of a high avidity BCR through repeat cycles of expansion. Symbol Name Synonyms...

...miRFPnanos, were derived from cyanobacteriochrome (CBCR) photoreceptors (Oliinyk et al., 2019). They were... 702 720 98,000 6.1 97 Monomer 510 4.5 117 12 CBCR-based FPs miRFP670nano https://www.addgene.org/...