We narrowed to 7 results for: ctns
-
TypeBlog Post...functions. Experiments come next, testing the correctness of the hypothesis. The results of experiments...
-
Neurodegeneration Plasmid Collection
TypeCollection...217-548 DCTN1 CMV ALS Trina Schroer 51221 CMV-CC2 DCTN1 CMV ALS Trina Schroer 51412 CMV-p150 DCTN1 CMV ALS...dynactin1-811 DCTN1 mKate2 hsp70 ALS Caren Norden 105971 pME mKate2-dynactin1-811 DCTN1 mKate2 ALS Caren...puro_shTBK1_3185 TBK1 ALS Agnel Sfeir 169375 pET3d-SF-DCTN1-TS DCTN1 SplitFIAsH, Strep, His T7 ALS, motor neuron...DAO_Halo_C_allele DAO Halo ALS Michael Ward 178156 DCTN1_Halo_C_allele DCTN1 Halo ALS Michael Ward 178157 DNMT1_Halo_C_allele...Parkinson's Patrick Aebischer 36154 pEGFP-p150Glued DCTN1 GFP CMV ALS David Stephens 36382 pSMP-DNMT1_1 DNMT1...CMV ALS Nicolas Charlet-Berguerand 74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA ... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric... -
Control AAV Preps
TypeCollection...Constitutive 1, 2, 5, 8, 9 Wilson 105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544... -
Cre-lox system
TypeCollection...Cre and gRNAs cTnT AAV Pu 87694 pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 light-activated Cre cTnT Mammalian Campbell... on GFP (CRE-DOG) CAG Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin ... -
Validated gRNA Sequences
TypeCollection...2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912 cut S. pyogenes 25119044 Jacks Ctnnb1 M. musculus... -
Penn Vector Core Partnership with Addgene
TypeCollection...James M. Wilson AV-9-PV1967 105543-AAV9 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG Control James M. Wilson AV-9-PV1969...