Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 3 of 3 results

  1. Qi Lab CRISPR Page

    Type
    Collection
    ...murine U6 promoter and sgRNA targeting endogenous CXCR4 gene 46920 pTDH3-dCas9 Yeast CEN/ARS vector (Leu2)...promoter and sgRNA targeting GFP (NT1) 46917 pU6-sgCXCR4-2 Human pSico-based U6 vector containing murine...

  2. Validated gRNA Sequences

    Type
    Collection
    ...CTGTGGTGGTGGCACCAGAA 59911 cut S. pyogenes 25119044 Jacks CXCR4 H. sapiens GCAGGTAGCAAAGTGACGCCGA 46917 interfere...TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S. pyogenes ...
Showing: 1 - 3 of 3 results