We narrowed to 10 results for: dcas9 dnmt3a
-
TypeBlog Post...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted...including pcDNA-dCas9-p300 Core and pcDNA3.3-Nm-dCas9-p300 Core, as well as pLV-dCas9-p300-P2A-PuroR for...pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs. For lentiviral expression, Fuw-dCas9-Dnmt3a...Dnmt3a and Fuw-dCas9-Dnmt3a-P2A-tagBFP are available from Rudolf Jaenisch’s lab, with the former also available...as ready-to-use lentivirus. Figure 3: dCas9-DNMT3A methylates cytosines at promoters and enhancers...Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion of dCas9 to a small DNA methyltransferase...Fusing dCas9 to a transcriptional activator like VP64 or VPR activates transcription, whereas dCas9-KRAB...
-
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post... Tethering dCas9 to the histone acetyltransferase p300 or the DNA methyltransferase DNMT3A allows researchers...Enzymatic domains tethered to dCas9 often interact with DNA independently of dCas9 targeting (Galonska 2018...binding is crucial for dCas9 to interfere with DNMT1 even through replication. The dCas9 also needs to be removeable...has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre. Selection...absent before. But other enzymatic fusions, such as dCas9-TET, can, like the iron ball-and-chain that they...-based epigenetic approach (spoiler alert: it’s dCas9… with no modifications). Ready to get started? ...dioxygenase When I started to work on building a CRISPR/dCas9-based tool for DNA demethylation in 2015, none existed... -
Hot Plasmids: Summer 2024
TypeBlog Post...protein (dCas9 shown here). D3L recruits the endogenous, autoinhibited methyltransferase DNMT3A to the ... a programmable epigenetic editor consisting of dCas9 fused to a DNA methyltransferase — that can drive...DNA-targeting proteins, so the team created versions using dCas9, zinc finger proteins, and transcription activator-like... -
CRISPR Plasmids - Epigenetics
TypeCollection...researchers have fused catalytically dead Cas9 (dCas9) to epigenetic modifiers. Common modifiers include...TET1 — activation through cytosine demethylation DNMT3A — repression through cytosine methylation MQ1 —... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional repressor peptide...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a ...Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator peptide can...specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your... separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene... separate gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene... -
27 Hot Plasmids from 2016
TypeBlog Post...catalytically inactive Cas9 (dCas9) with the catalytic domain from DNA methyltransferase, DNMT3A. Co-expression of...creating a new dCas9-VPR expression plasmid that uses the piggybac transposase to integrate dCas9-VPR into ... is genomic integration of dCas9-VPR and controlled expression of the dCas9-VPR transgene by doxycycline... activator developed by the Church lab, termed “dCas9-VPR”, which facilitates robust activation of target...target genes (20-40x greater than standard dCas9-VP64 activators) when introduced into mammalian cells....activate target genes, the relatively large size of dCas9-VPR limits one’s ability to package it into lentivirus...transfection precluding the need for virus. Furthermore, dCAS9-VPR expression is under the control of the TRE promoter... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...separate accessory pack is available for dCas9 and FokI-dCas9. Yamamoto Multiplex CRISPR/Cas9-based genome...vector Mammalian Lentiviral expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Mammalian U6 yes, nick S. pyogenes Conklin pXFokI-dCas9 60901 Mammalian U6 yes, FokI S. pyogenes Conklin...Mammalian U6 none S. aureus Joung pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro 71236 Mammalian/Lentiviral hU6 yes... -
CRISPR Guide
TypeGuide...achieved by using orthogonal dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent...human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single...imaging of proteins in living cells (Figure 9B) dCas9-VPR — dCas9 fused to several different activation domains...Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene...utilizes biotin tagging of dCas9 by fusing a biotin acceptor site to dCas9 and co-expressing BirA biotin... defense CRISPRa CRISPR Activation; using a dCas9 or dCas9-activator with a gRNA to increase transcription...target gene CRISPRi CRISPR Interference; using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription... -
CRISPR Guide
TypeCollection...achieved by using orthogonal dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent...human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single...imaging of proteins in living cells (Figure 9B) dCas9-VPR — dCas9 fused to several different activation domains...Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene...utilizes biotin tagging of dCas9 by fusing a biotin acceptor site to dCas9 and co-expressing BirA biotin... defense CRISPRa CRISPR Activation; using a dCas9 or dCas9-activator with a gRNA to increase transcription...target gene CRISPRi CRISPR Interference; using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription... -
Validated gRNA Sequences
TypeCollection...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...