...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted...For lentiviral expression, Fuw-dCas9-Dnmt3a and Fuw-dCas9-Dnmt3a-P2A-tagBFP are available from Rudolf ...transient and quickly reversed in culture. However, DNMT3A-induced methylation persisted throughout a 100 ...

... demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1. RNA...

...acetyltransferase p300 or the DNA methyltransferase DNMT3A allows researchers to easily add biochemical marks...

...histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These modifications...

...gRNA to GFP 41821 gRNA_DNMT3a-T1 A gRNA to DNMT3a 41822 gRNA_DNMT3a-T2 A gRNA to DNMT3a 41823 gRNA_DNMT3b...

... pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S....

... demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1. These...

...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens...

...the catalytic domain from DNA methyltransferase, DNMT3A. Co-expression of this modified Cas9 along with...