We narrowed to 58 results for: ef1
-
TypeCollection...from the EF1 promoter pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-...truncated EF1 promoter pCDH-EF1S-Nluc 73033 Expresses Nluc from a truncated EF1 promoter pCDH-EF1s-copGFP...from the EF1 promoter pAdx-EF1-tdTomato 73354 Expresses tdTomato from the EF1 promoter pICPIS-EF1 73355 ...from the EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter...pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses Nluc and copGFP from the EF1 promoter pCDH-EF1-Nluc ...using shuttle vectors pICPIS-EF1 and pICPIS-CB. pICPIS-EF1 contains the EF1 promoter while pICPIS-CB contains...promoter pAdxEF1-FLPe-tdTomato 73352 Expresses FLPe and tdTomato from the EF1 promoter pAdx-EF1-copGFP ...
-
Sequencing Primers
TypeGuide...beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward... -
New and Upcoming Viral Vectors - May 2020
TypeBlog Post...pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein pLVX-EF1alpha-SARS-CoV...the E protein (pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro...Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry Karl Deisseroth...Depositor 69570 AAV1 pAAV-EF1a-N-CretrcintG Connie Cepko 69571 AAV1 pAAV-EF1a-C-CreintG Connie Cepko ...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression...Deisseroth 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP... 75469 AAV1 pAAV-EF1a-Flp-DOG-NW Connie Cepko Viral vectors coming soon! These vectors listed below... -
New and Upcoming Viral Vectors - December 2019
TypeBlog Post...AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox...pAAV-Ef1a-fDIO mCherry 99130 AAVrg pAAV-mDlx-NLS-mRuby2 112677 AAV1, AAV2 pOTTC1032 - pAAV EF1a Nuc-flox...dependent. Plasmid Serotype Name 124603 AAV9 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 124650 AAV9...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Biosensor ...GP-AAV-CAG-FLEX-jGCaMP7s-WPRE 105714 AAV8 pAAV-Ef1a-fDIO-GCaMP6s Neurotransmitter sensors: Dopamine... Plasmid Serotype Name 87306 AAVrg, AAV5 AAV pEF1a-DIO-FLPo-WPRE-hGHpA Additional resources... -
New and Upcoming Viral Vectors - September 2019
TypeBlog Post...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter directs...50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral vectors...AAVrg. See our new additions here: Cre vectors pAAV-EF1a-fDIO-Cre (121675-AAV9, 121675-AAVrg) pENN.AAV.hSyn.Cre.WPRE.hGH...pAAV-hSyn-hChR2(H134R)-mCherry (26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) Calcium Sensors... -
New and Upcoming Viral Vectors - June 2019
TypeBlog Post...Serotype Name 55637 AAVrg pAAV-EF1a-Flpo 87306 AAV1 AAV pEF1a-DIO-FLPo-WPRE-hGHp Other new viral...Serotype Name 55634 AAV1 pAAV-EF1a-mCherry-IRES-Flpo 55637 AAV1 pAAV-EF1a-Flpo Chemogenetics Plasmid...-jGCaMP7c variant 1513-WPRE 105714 AAV8 pAAV-Ef1a-fDIO-GCaMP6s Optogenetics Plasmid Serotype...pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603 AAV9 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 Additional... -
New Viral Vectors - Fall 2024
TypeBlog Post... Stanley Thomas Carmichael New viral prep pAAV-EF1a-fDIO-Cre AAV5 Recombinases Esteban Engel New serotype...pAAV-CaMKIIa-EGFP AAV1 Controls Bryan Roth New serotype pAAV-Ef1a-DIO mScarlet AAV5 Controls Karl Deisseroth New serotype...AAV1 Optogenetics Edward Boyden New serotype pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE AAV1 Optogenetics Karl... -
New and Upcoming Viral Vectors - Spring 2019
TypeBlog Post... 121675 AAV9 pAAV-EF1a-fDIO-Cre (FLP-dependent CRE) 55634 AAV1 pAAV-EF1a-mCherry-IRES-Flpo 55637... 55637 AAV1 pAAV-EF1a-Flpo Calcium sensors Plasmid Serotype Name 104496 AAV1 GP-AAV-CAG-FLEX-jGCaMP7f-WPRE... -
Plasmids 101: The Promoter Region – Let's Go!
TypeBlog Post...enhancer region. Can be silenced in some cell types. EF1a General expression mRNA Strong mammalian expression...independently or together. Regulated by GAL4 and GAL 80. TEF1 General expression mRNA Yeast transcription elongation...factor promoter Constitutive Analogous to mammalian EF1a promoter. GDS General expression mRNA Strong ... -
New Viral Vectors - Summer 2024
TypeBlog Post...Yizhar New viral service with multiple serotypes pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE AAV1, AAV5 Optogenetics...pAAV-hSyn-GRAB_ACh3.0 AAV9 Biosensors Li New viral service pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New... -
New Viral Vectors - March 2024
TypeBlog Post...PHP.eB Controls Wilson New viral vector pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype...AAV PHP.eB Controls Deisseroth New serotype pAAV-Ef1a-mCherry AAV PHP.eB Controls Deisseroth New serotype... -
New Viral Vectors - Winter 2025
TypeBlog Post...AAV1 Biosensor Marianne Fyhn New viral prep pAAV-Ef1a-fDIO EYFP AAV5. AAV8, AAVrg Control Karl Deisseroth...AAV1 Chemogenetics Bryan Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool... -
Viral Production at Addgene
TypeBlog Post...: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral...Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth... -
Hot Biosensors 2022: Year-End Roundup
TypeBlog Post...here! Find viral preps here: pAAV-EF1a-DIO-JEDI-2P-WPRE and pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE Liu Z, et al... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...adeno-associated viral vectors (AAV) available - AAV-EF1a-BbChT and AAV-EF1a-BbTagBY. These constructs contain two XFPs... -
New Viral Vectors - Spring 2025
TypeBlog Post...Optogenetics Ofer Yizhar New viral tool pAAV-Ef1a-fDIO hChR2(H134R)-EYFP AAVrg Optogenetics Karl Deisseroth... -
Hot Plasmids - October 2022
TypeBlog Post...constructs are currently available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find... -
Hot Plasmids and Viral Preps - July 2021
TypeBlog Post...experiments with the Cre-OFF/FLP-ON vector 137128-AAV8: Ef1a-Coff/Fon-sRGECO ... -
DAP arrays for multiplex gene editing
TypeBlog Post...strategy, the need for lengthy promoters, such as U6 or EF1α promoters, has limited the number of gRNAs that ... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post...selection. Expression is driven by a fairly strong EF1alpha promoter. We have verified expression of correctly-sized...